Loading...

Detail Information of piRNA: piR-hsa-103

General Information
piRBase Id piR-hsa-103 Accession DQ588635
Organism Human Number of methods 1
Sequence TGGGACAGGTAACACAGGCTTTAGGCTGGC Number of papers 4
Length 30 Golden piRNA -
Aliases piR-55747; PIR193230; PIR49746;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
2 N/A N/A 16751777 small RNA testis
3 N/A 2 22313525 small RNA epididymis
430 GSM2067753 11 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 1 27068805 small RNA Seminal plasma(asthenozoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 19:16037633-16037663:+ LINC00905 ENST00000664035; LINC00905 ENST00000659686; LINC00905 ENST00000656142; LINC00905 ENST00000662251; LINC00905 ENST00000665134; LINC00905 ENST00000658675; LINC00905 ENST00000671363; LINC00905 ENST00000662482; LINC00905 ENST00000662052; LINC00905 ENST00000658008; LINC00905 ENST00000658373; LINC00905 ENST00000654208; LINC00905 ENST00000588117; LINC00905 ENST00000654929; LINC00905 ENST00000662221; LINC00905 ENST00000588838; ENSG00000277766 ENST00000612686;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.