Loading...
piRBase Id | piR-hsa-101 | Accession | DQ598558 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | GTGGAAGTGACAGGAGCTCAGCATCCCTGT | Number of papers | 3 |
Length | 30 | Golden piRNA | - |
Aliases | piR-36624; PIR193228; PIR59669; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 19:16037006-16037036:+ | LINC00905 ENST00000664035; LINC00905 ENST00000659686; LINC00905 ENST00000656142; LINC00905 ENST00000662251; LINC00905 ENST00000665134; LINC00905 ENST00000658675; LINC00905 ENST00000671363; LINC00905 ENST00000662482; LINC00905 ENST00000662052; LINC00905 ENST00000658008; LINC00905 ENST00000658373; LINC00905 ENST00000654208; LINC00905 ENST00000588117; LINC00905 ENST00000654929; LINC00905 ENST00000662221; LINC00905 ENST00000588838; ENSG00000277766 ENST00000612686; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 16751777 | Journal | Nature. 2006 Jul 13;442(7099):203-7. |
---|---|---|---|
Title | A novel class of small RNAs bind to MILI protein in mouse testes | ||
Authors | Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T. |
PubMed | 22313525 | Journal | Gene. 2012 Apr 15;497(2):330-5. |
---|---|---|---|
Title | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. | ||
Authors | Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY. |