Loading...

Detail Information of piRNA: piR-hsa-101

General Information
piRBase Id piR-hsa-101 Accession DQ598558
Organism Human Number of methods 1
Sequence GTGGAAGTGACAGGAGCTCAGCATCCCTGT Number of papers 3
Length 30 Golden piRNA -
Aliases piR-36624; PIR193228; PIR59669;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
2 N/A N/A 16751777 small RNA testis
3 N/A 2 22313525 small RNA epididymis
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 19:16037006-16037036:+ LINC00905 ENST00000664035; LINC00905 ENST00000659686; LINC00905 ENST00000656142; LINC00905 ENST00000662251; LINC00905 ENST00000665134; LINC00905 ENST00000658675; LINC00905 ENST00000671363; LINC00905 ENST00000662482; LINC00905 ENST00000662052; LINC00905 ENST00000658008; LINC00905 ENST00000658373; LINC00905 ENST00000654208; LINC00905 ENST00000588117; LINC00905 ENST00000654929; LINC00905 ENST00000662221; LINC00905 ENST00000588838; ENSG00000277766 ENST00000612686;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.