Loading...

Detail Information of piRNA: piR-hsa-1

General Information
piRBase Id piR-hsa-1 Accession N/A
Organism Human Number of methods 1
Sequence AGAAGACATTCGTGGAGGCGTC Number of papers 1
Length 22 Golden piRNA -
Aliases PIR192551; PIR192868; PIR192285; PIR192296; PIR192306; PIR192318; PIR192327; PIR192337; PIR192349; PIR192376; PIR192403; PIR192412; PIR192424; PIR192446; PIR192456; PIR192480; PIR192493; PIR192515; PIR192528; PIR192578; PIR192595; PIR192614; PIR192627; PIR192649; PIR192659; PIR192681; PIR192693; PIR192723; PIR192743; PIR192753; PIR192788; PIR192811; PIR192842; PIR192885; PIR192914; PIR192934; PIR192944; PIR192979; PIR192997; PIR193023; PIR193035; PIR193046; PIR193052; PIR193077; PIR193087; PIR193114; PIR193124; PIR193136;
Datasets
Dataset Accession Reads PubMed Method Tissue
2 N/A N/A 16751777 small RNA testis
Location in GRCh38
48 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:101753169-101753191:+ DNM1P47 ENST00000561463; DNM1P47 ENST00000571780;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.