Loading...

Detail Information of piRNA: piR-gga-8

General Information
piRBase Id piR-gga-8 Accession N/A
Organism Chicken Number of methods 2
Sequence GCATTGTGGTTCAGTGGTAGAATTC Number of papers 3
Length 25 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 34552 22418847 Small RNA stage X embryos
40 GSM710258 12730 22418847 Small RNA stage HH10 embryos
210 GSM1477978 153 25185950 small RNA embryonic day E6.0 primordial germ cells
211 GSM1477979 3397 25185950 small RNA embryonic stage X (E0) blastodermal cells
212 GSM1477980 119 25185950 small RNA embryonic day E6.0 gonadal stromal cells
213 GSM1477981 36 25185950 small RNA embryonic day E6.0 fibroblasts
453 GSM1096598 21 23523368 small RNA Wild Type Adult testes
454 GSM1096613 17 23523368 oxidized small RNA Wild Type Adult testes
Location in GRCg6
No loci found in GRCg6!
To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.
PubMed 25185950 Journal Bmc Genomics.2014;15(1):757
Title Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells
Authors Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.