Loading...
| piRBase Id | piR-gga-63 | Accession | N/A |
|---|---|---|---|
| Organism | Chicken | Number of methods | 1 |
| Sequence | AGAGGTGTAGAATAAGTGGGAGGCCCC | Number of papers | 5 |
| Length | 27 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 39 | GSM710257 | 5531 | 22418847 | Small RNA | stage X embryos |
| 40 | GSM710258 | 1001 | 22418847 | Small RNA | stage HH10 embryos |
| 209 | N/A | N/A | 28536021 | small RNA | testis |
| 210 | GSM1477978 | 132 | 25185950 | small RNA | embryonic day E6.0 primordial germ cells |
| 211 | GSM1477979 | 1409 | 25185950 | small RNA | embryonic stage X (E0) blastodermal cells |
| 212 | GSM1477980 | 126 | 25185950 | small RNA | embryonic day E6.0 gonadal stromal cells |
| 213 | GSM1477981 | 327 | 25185950 | small RNA | embryonic day E6.0 fibroblasts |
| 436 | GSM2890297 | 8 | 29667432 | small RNA | sperm |
| 453 | GSM1096598 | 2 | 23523368 | small RNA | Wild Type Adult testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 16:1842327-1842354:+ | ENSGALG00000050132 ENSGALT00000101066; | rRNA rRNA LSU-rRNA_Hsa; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22418847 | Journal | RNA Biol. 2012 Feb;9(2):212-27. |
|---|---|---|---|
| Title | Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation. | ||
| Authors | Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH. | ||
| PubMed | 28536021 | Journal | Int J Biol Macromol.2017 Oct;103:957-964 |
|---|---|---|---|
| Title | Effect of dietary Astragalus Polysaccharide supplements on testicular piRNA expression profiles of breeding cocks | ||
| Authors | Wu.S,Li.Y,Chen.S,Liang.S,Ren.X,Guo.W,Sun.Q,Yang.X, | ||
| PubMed | 25185950 | Journal | Bmc Genomics.2014;15(1):757 |
|---|---|---|---|
| Title | Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells | ||
| Authors | Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han | ||
| PubMed | 29667432 | Journal | Br Poult Sci. 2018 Aug;59(4):371-380. doi: 10.1080/00071668.2018.1464123. Epub 2018 Jun 1. |
|---|---|---|---|
| Title | Identification and characterisation of microRNAs and Piwi-interacting RNAs in cockerels' spermatozoa by Solexa sequencing. | ||
| Authors | Wu S, Guo J, Zhu L, Yang J, Chen S, Yang X. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||