Loading...

Detail Information of piRNA: piR-gga-63

General Information
piRBase Id piR-gga-63 Accession N/A
Organism Chicken Number of methods 1
Sequence AGAGGTGTAGAATAAGTGGGAGGCCCC Number of papers 5
Length 27 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 5531 22418847 Small RNA stage X embryos
40 GSM710258 1001 22418847 Small RNA stage HH10 embryos
209 N/A N/A 28536021 small RNA testis
210 GSM1477978 132 25185950 small RNA embryonic day E6.0 primordial germ cells
211 GSM1477979 1409 25185950 small RNA embryonic stage X (E0) blastodermal cells
212 GSM1477980 126 25185950 small RNA embryonic day E6.0 gonadal stromal cells
213 GSM1477981 327 25185950 small RNA embryonic day E6.0 fibroblasts
436 GSM2890297 8 29667432 small RNA sperm
453 GSM1096598 2 23523368 small RNA Wild Type Adult testes
Location in GRCg6
1 best hit(s) with 0 mismatch(es) in GRCg6
No. Location Gene RepeatMaker
Location 1 16:1842327-1842354:+ ENSGALG00000050132 ENSGALT00000101066; rRNA rRNA LSU-rRNA_Hsa;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.
PubMed 28536021 Journal Int J Biol Macromol.2017 Oct;103:957-964
Title Effect of dietary Astragalus Polysaccharide supplements on testicular piRNA expression profiles of breeding cocks
Authors Wu.S,Li.Y,Chen.S,Liang.S,Ren.X,Guo.W,Sun.Q,Yang.X,
PubMed 25185950 Journal Bmc Genomics.2014;15(1):757
Title Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells
Authors Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han
PubMed 29667432 Journal Br Poult Sci. 2018 Aug;59(4):371-380. doi: 10.1080/00071668.2018.1464123. Epub 2018 Jun 1.
Title Identification and characterisation of microRNAs and Piwi-interacting RNAs in cockerels' spermatozoa by Solexa sequencing.
Authors Wu S, Guo J, Zhu L, Yang J, Chen S, Yang X.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.