Loading...

Detail Information of piRNA: piR-gga-5

General Information
piRBase Id piR-gga-5 Accession N/A
Organism Chicken Number of methods 1
Sequence ACTTAAATGTGGATGTGCTTGCT Number of papers 1
Length 23 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 43449 22418847 Small RNA stage X embryos
40 GSM710258 45847 22418847 Small RNA stage HH10 embryos
Location in GRCg6
1 best hit(s) with 0 mismatch(es) in GRCg6
No. Location Gene RepeatMaker
Location 1 4:57084748-57084771:+ LARP7 ENSGALT00000019679; LARP7 ENSGALT00000095949; gga-mir-302a ENSGALT00000029033;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.