Loading...

Detail Information of piRNA: piR-gga-383006

General Information
piRBase Id piR-gga-383006 Accession N/A
Organism Chicken Number of methods 1
Sequence AGCACTGCAAGAGGGAGAGAGAT Number of papers 2
Length 23 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
40 GSM710258 49 22418847 Small RNA stage HH10 embryos
453 GSM1096598 2 23523368 small RNA Wild Type Adult testes
Location in GRCg6
7 best hit(s) with 0 mismatch(es) in GRCg6
No. Location Gene RepeatMaker
Location 1 1:65487256-65487279:+ ENSGALG00000052327 ENSGALT00000106598; ENSGALG00000052327 ENSGALT00000099256; ENSGALG00000051667 ENSGALT00000104023;
Location 2 1:65490460-65490483:+ ENSGALG00000052327 ENSGALT00000106598; ENSGALG00000052327 ENSGALT00000099256; ENSGALG00000052622 ENSGALT00000095417;
Location 3 1:65725681-65725704:+ ENSGALG00000049759 ENSGALT00000105693;
Location 4 1:65728828-65728851:+ ENSGALG00000049640 ENSGALT00000107500;
Location 5 1:65838604-65838627:+ SOX5 ENSGALT00000105978; gga-mir-6608-1 ENSGALT00000097887;
Location 6 1:65841814-65841837:+ SOX5 ENSGALT00000105978; gga-mir-6608-1 ENSGALT00000098853;
Location 7 1:65845023-65845046:+ SOX5 ENSGALT00000105978; gga-mir-6608-1 ENSGALT00000099492;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.