Loading...

Detail Information of piRNA: piR-gga-23

General Information
piRBase Id piR-gga-23 Accession N/A
Organism Chicken Number of methods 1
Sequence GGTGTAGAATAAGTGGGAGGCCC Number of papers 2
Length 23 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 12232 22418847 Small RNA stage X embryos
40 GSM710258 4072 22418847 Small RNA stage HH10 embryos
453 GSM1096598 1 23523368 small RNA Wild Type Adult testes
Location in GRCg6
1 best hit(s) with 0 mismatch(es) in GRCg6
No. Location Gene RepeatMaker
Location 1 16:1842330-1842353:+ ENSGALG00000050132 ENSGALT00000101066; rRNA rRNA LSU-rRNA_Hsa;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.