Loading...
| piRBase Id | piR-gga-22 | Accession | N/A |
|---|---|---|---|
| Organism | Chicken | Number of methods | 2 |
| Sequence | AGACTCTGGCATGCTAACTAGTTACG | Number of papers | 3 |
| Length | 26 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 39 | GSM710257 | 13335 | 22418847 | Small RNA | stage X embryos |
| 40 | GSM710258 | 321 | 22418847 | Small RNA | stage HH10 embryos |
| 210 | GSM1477978 | 2 | 25185950 | small RNA | embryonic day E6.0 primordial germ cells |
| 211 | GSM1477979 | 1 | 25185950 | small RNA | embryonic stage X (E0) blastodermal cells |
| 212 | GSM1477980 | 9 | 25185950 | small RNA | embryonic day E6.0 gonadal stromal cells |
| 213 | GSM1477981 | 6 | 25185950 | small RNA | embryonic day E6.0 fibroblasts |
| 454 | GSM1096613 | 45 | 23523368 | oxidized small RNA | Wild Type Adult testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 16:1801042-1801068:+ | ENSGALG00000050132 ENSGALT00000101066; | rRNA rRNA SSU-rRNA_Hsa; |
| Location 2 | 16:1817881-1817907:+ | ENSGALG00000050132 ENSGALT00000101066; | rRNA rRNA SSU-rRNA_Hsa; |
| Location 3 | 16:1834991-1835017:+ | ENSGALG00000050132 ENSGALT00000101066; | rRNA rRNA SSU-rRNA_Hsa; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22418847 | Journal | RNA Biol. 2012 Feb;9(2):212-27. |
|---|---|---|---|
| Title | Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation. | ||
| Authors | Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH. | ||
| PubMed | 25185950 | Journal | Bmc Genomics.2014;15(1):757 |
|---|---|---|---|
| Title | Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells | ||
| Authors | Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||