Loading...
| piRBase Id | piR-gga-218 | Accession | N/A |
|---|---|---|---|
| Organism | Chicken | Number of methods | 2 |
| Sequence | GTTTCTGTAGTGTAGTGGTTATCACGTT | Number of papers | 4 |
| Length | 28 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 39 | GSM710257 | 2122 | 22418847 | Small RNA | stage X embryos |
| 40 | GSM710258 | 915 | 22418847 | Small RNA | stage HH10 embryos |
| 209 | N/A | N/A | 28536021 | small RNA | testis |
| 210 | GSM1477978 | 8 | 25185950 | small RNA | embryonic day E6.0 primordial germ cells |
| 211 | GSM1477979 | 80 | 25185950 | small RNA | embryonic stage X (E0) blastodermal cells |
| 212 | GSM1477980 | 5 | 25185950 | small RNA | embryonic day E6.0 gonadal stromal cells |
| 213 | GSM1477981 | 68 | 25185950 | small RNA | embryonic day E6.0 fibroblasts |
| 453 | GSM1096598 | 30 | 23523368 | small RNA | Wild Type Adult testes |
| 454 | GSM1096613 | 6 | 23523368 | oxidized small RNA | Wild Type Adult testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 16:2374543-2374571:- | ENSGALG00000040101 ENSGALT00000075743; ENSGALG00000013101 ENSGALT00000093726; ENSGALG00000013101 ENSGALT00000094820; BG8 ENSGALT00000042868; ENSGALG00000049448 ENSGALT00000106199; TRIM7.2 ENSGALT00000060138; ENSGALG00000055025 ENSGALT00000070879; IL4I1 ENSGALT00000000109; | tRNA tRNA tRNA-Val-GTY; |
| Location 2 | 16:2480348-2480376:- | tRNA tRNA tRNA-Val-GTY; | |
| Location 3 | 16:2498155-2498183:- | TRIM27.2 ENSGALT00000091232; | tRNA tRNA tRNA-Val-GTG; |
| Location 4 | 16:2499210-2499238:+ | TRIM27.2 ENSGALT00000091232; | tRNA tRNA tRNA-Val-GTG; |
| Location 5 | 16:2519531-2519559:- | TRIM27.2 ENSGALT00000102169; | tRNA tRNA tRNA-Val-GTG; |
| Location 6 | 7:22388708-22388736:- | WNT10A ENSGALT00000018526; | tRNA tRNA tRNA-Val-GTY; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22418847 | Journal | RNA Biol. 2012 Feb;9(2):212-27. |
|---|---|---|---|
| Title | Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation. | ||
| Authors | Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH. | ||
| PubMed | 28536021 | Journal | Int J Biol Macromol.2017 Oct;103:957-964 |
|---|---|---|---|
| Title | Effect of dietary Astragalus Polysaccharide supplements on testicular piRNA expression profiles of breeding cocks | ||
| Authors | Wu.S,Li.Y,Chen.S,Liang.S,Ren.X,Guo.W,Sun.Q,Yang.X, | ||
| PubMed | 25185950 | Journal | Bmc Genomics.2014;15(1):757 |
|---|---|---|---|
| Title | Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells | ||
| Authors | Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||