Loading...

Detail Information of piRNA: piR-gga-17

General Information
piRBase Id piR-gga-17 Accession N/A
Organism Chicken Number of methods 1
Sequence TCTGGCTGAGATAGGCGACCCATCGTG Number of papers 2
Length 27 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 18556 22418847 Small RNA stage X embryos
40 GSM710258 1010 22418847 Small RNA stage HH10 embryos
210 GSM1477978 47 25185950 small RNA embryonic day E6.0 primordial germ cells
211 GSM1477979 2957 25185950 small RNA embryonic stage X (E0) blastodermal cells
212 GSM1477980 3 25185950 small RNA embryonic day E6.0 gonadal stromal cells
Location in GRCg6
8 best hit(s) with 0 mismatch(es) in GRCg6
No. Location Gene RepeatMaker
Location 1 14:14996923-14996950:+ LTR ERVL GGERVL18-int;
Location 2 2:51984085-51984112:+ LTR ERVL GGERVL18-int;
Location 3 2:72506149-72506176:+ LTR ERVL GGERVL18-int;
Location 4 W:941362-941389:- LTR ERVL GGERVL18-int;
Location 5 W:1062530-1062557:+ LTR ERVL GGERVL18-int;
Location 6 W:2660069-2660096:+ LTR ERVL GGERVL18-int;
Location 7 W:2997055-2997082:- LTR ERVL GGERVL18-int;
Location 8 W:5959951-5959978:+ SPIN1W ENSGALT00000077692; LTR ERVL GGERVL18-int;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.
PubMed 25185950 Journal Bmc Genomics.2014;15(1):757
Title Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells
Authors Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han