Loading...
| piRBase Id | piR-gga-16 | Accession | N/A |
|---|---|---|---|
| Organism | Chicken | Number of methods | 2 |
| Sequence | TGAGAACTGAATTCCATGGACTG | Number of papers | 2 |
| Length | 23 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 4:88746764-88746787:- | DDRGK1 ENSGALT00000025785; gga-mir-146c ENSGALT00000041410; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22418847 | Journal | RNA Biol. 2012 Feb;9(2):212-27. |
|---|---|---|---|
| Title | Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation. | ||
| Authors | Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||