Loading...

Detail Information of piRNA: piR-gga-16

General Information
piRBase Id piR-gga-16 Accession N/A
Organism Chicken Number of methods 2
Sequence TGAGAACTGAATTCCATGGACTG Number of papers 2
Length 23 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 18723 22418847 Small RNA stage X embryos
40 GSM710258 80243 22418847 Small RNA stage HH10 embryos
453 GSM1096598 3111 23523368 small RNA Wild Type Adult testes
454 GSM1096613 127 23523368 oxidized small RNA Wild Type Adult testes
Location in GRCg6
1 best hit(s) with 0 mismatch(es) in GRCg6
No. Location Gene RepeatMaker
Location 1 4:88746764-88746787:- DDRGK1 ENSGALT00000025785; gga-mir-146c ENSGALT00000041410;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.