Loading...

Detail Information of piRNA: piR-gga-14

General Information
piRBase Id piR-gga-14 Accession N/A
Organism Chicken Number of methods 1
Sequence GCATGTGGTTCAGTGGTAGAATTC Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
39 GSM710257 19791 22418847 Small RNA stage X embryos
40 GSM710258 2435 22418847 Small RNA stage HH10 embryos
Location in GRCg6
No loci found in GRCg6!
To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22418847 Journal RNA Biol. 2012 Feb;9(2):212-27.
Title Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation.
Authors Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH.