Loading...
| piRBase Id | piR-gga-14 | Accession | N/A |
|---|---|---|---|
| Organism | Chicken | Number of methods | 1 |
| Sequence | GCATGTGGTTCAGTGGTAGAATTC | Number of papers | 1 |
| Length | 24 | Golden piRNA | - |
| Aliases | N/A | ||
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22418847 | Journal | RNA Biol. 2012 Feb;9(2):212-27. |
|---|---|---|---|
| Title | Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation. | ||
| Authors | Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH. | ||