Loading...
| piRBase Id | piR-gga-10 | Accession | N/A |
|---|---|---|---|
| Organism | Chicken | Number of methods | 1 |
| Sequence | TCGAGATCACGAACTCAACCAGTGCAT | Number of papers | 2 |
| Length | 27 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 39 | GSM710257 | 25092 | 22418847 | Small RNA | stage X embryos |
| 40 | GSM710258 | 930 | 22418847 | Small RNA | stage HH10 embryos |
| 210 | GSM1477978 | 20 | 25185950 | small RNA | embryonic day E6.0 primordial germ cells |
| 211 | GSM1477979 | 1158 | 25185950 | small RNA | embryonic stage X (E0) blastodermal cells |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 1:172523203-172523230:- | LINE CR1 CR1-B; | |
| Location 2 | 4:41998238-41998265:+ | ENSGALG00000049124 ENSGALT00000101977; | LINE CR1 CR1-B; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22418847 | Journal | RNA Biol. 2012 Feb;9(2):212-27. |
|---|---|---|---|
| Title | Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation. | ||
| Authors | Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH. | ||
| PubMed | 25185950 | Journal | Bmc Genomics.2014;15(1):757 |
|---|---|---|---|
| Title | Small non-coding RNA profiling and the role of piRNA pathway genes in the protection of chicken primordial germ cells | ||
| Authors | Deivendran Rengaraj,Sang In Lee,Tae Sub Park,Hong Jo Lee,Young Min Kim,Yoon Ah Sohn,Myunghee Jung,Seung-Jae Noh,Hojin Jung,Jae Yong Han | ||