Specific Information of Small Protein : SPROMMU63392
General Information
| Small Protein ID | SPROMMU63392 |
| Organism | Mouse (Mus musculus) |
| Small Protein Sequence | IGVNHETYDNSFKIFSNGSCTTTA* |
| RNA Sequence | ATAGGTGTGAACCACGAGACATATGACAACTCATTCAAGATTTTCAGCAATGGATCCTGCACAACAACTGCTTAG |
| Protein Length | 24 |
| Start Codon | ATA |
| Location | chr1:11224044-11224119:- |
| Blocks | 11224044-11224119 |
| Mean PhyloCSF | 0 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSMUSG00000048960; Prex2; ENSMUSG00000101827; Gm28686; NONMMUG000100; |
| Mass (Da) | mono. 2605.2; avg. 2606.8 |
Ribosome profiling
| Min Ribo P value | 0.041063 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE99585_alt | C57BL/6-Quadriceps muscle | WT | GSM2648077; GSM2648078 | 28615380; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |       |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROMMU198074 | 22 | GTG | - | 11224044-11224113 |