Specific Information of Small Protein : SPROMMU198074
General Information
| Small Protein ID | SPROMMU198074 |
| Organism | Mouse (Mus musculus) |
| Small Protein Sequence | VNHETYDNSFKIFSNGSCTTTA* |
| RNA Sequence | GTGAACCACGAGACATATGACAACTCATTCAAGATTTTCAGCAATGGATCCTGCACAACAACTGCTTAG |
| Protein Length | 22 |
| Start Codon | GTG |
| Location | chr1:11224044-11224113:- |
| Blocks | 11224044-11224113 |
| Mean PhyloCSF | 0 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSMUSG00000048960; Prex2; ENSMUSG00000101827; Gm28686; NONMMUG000100; |
| Mass (Da) | mono. 2435.1; avg. 2436.6 |
Ribosome profiling
| Min Ribo P value | 0.033802 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE22004_alt | C57BL/6-Neutrophils cultured from bone marrow | WT | GSM546987 | 20703300; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |       |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROMMU63392 | 24 | ATA | - | 11224044-11224119 |