Specific Information of Small Protein : SPROMMU220488
General Information
Small Protein IDSPROMMU220488
OrganismMouse (Mus musculus)
Small Protein SequenceVVDLMAYMATK
RNA SequenceGTGGTGGACCTCATGGCCTACATGGCCACCAAG
Protein Length11
Start CodonGTG
Locationchr1:11223566-11223599:-
Blocks11223566-11223599
Mean PhyloCSF0
Data SourceRibosome profiling;
Related GenesENSMUSG00000048960; Prex2; ENSMUSG00000101827; Gm28686; NONMMUG000100;
Mass (Da)mono. 1240.6; avg. 1241.5
Ribosome profiling
Ribo-seq IDEnsembl Gene IDEnsembl Transcript IDSymbolGene TypeTIS TypeRibo P valueTIS P valueStart On TransStop On TransIn-frame CountRibo-seq RPKM
GSE22004_altENSMUSG00000101827.1ENSMUST00000187404.1Gm28686Processed_pseudogeneNovel0.030242None575608424.4680490
Min Ribo P value0.030242
Min TIS P valueNone
Ribo-seq IDCell or TissuePhenotypeRibo-seq Source DetailsPMID
GSE22004_altC57BL/6-Neutrophils cultured from bone marrowWTGSM54698720703300;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
Related Small Proteins with Different TISs
SmProt IDSmall Protein LengthStart CodonStrandBlocks
SPROMMU21077210GTG-11223566-11223596