Specific Information of Small Protein : SPROMMU220488
General Information
Small Protein ID | SPROMMU220488 |
Organism | Mouse (Mus musculus) |
Small Protein Sequence | VVDLMAYMATK |
RNA Sequence | GTGGTGGACCTCATGGCCTACATGGCCACCAAG |
Protein Length | 11 |
Start Codon | GTG |
Location | chr1:11223566-11223599:- |
Blocks | 11223566-11223599 |
Mean PhyloCSF | 0 |
Data Source | Ribosome profiling; |
Related Genes | ENSMUSG00000048960; Prex2; ENSMUSG00000101827; Gm28686; NONMMUG000100; |
Mass (Da) | mono. 1240.6; avg. 1241.5 |
Ribosome profiling
Min Ribo P value | 0.030242 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE22004_alt | C57BL/6-Neutrophils cultured from bone marrow | WT | GSM546987 | 20703300; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROMMU210772 | 10 | GTG | - | 11223566-11223596 |