Specific Information of Small Protein : SPROMMU210772
General Information
Small Protein ID | SPROMMU210772 |
Organism | Mouse (Mus musculus) |
Small Protein Sequence | VDLMAYMATK |
RNA Sequence | GTGGACCTCATGGCCTACATGGCCACCAAG |
Protein Length | 10 |
Start Codon | GTG |
Location | chr1:11223566-11223596:- |
Blocks | 11223566-11223596 |
Mean PhyloCSF | 0 |
Data Source | Ribosome profiling; |
Related Genes | ENSMUSG00000048960; Prex2; ENSMUSG00000101827; Gm28686; NONMMUG000100; |
Mass (Da) | mono. 1141.6; avg. 1142.4 |
Ribosome profiling
Min Ribo P value | 0.029557 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE60095_alt | ES cell | WT | GSM1464901 | 25159147; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROMMU220488 | 11 | GTG | - | 11223566-11223599 |