Specific Information of Small Protein : SPROHSA91159
General Information
| Small Protein ID | SPROHSA91159 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | RGFRDILLRGNCACDVGRV* |
| RNA Sequence | AGGGGCTTCAGAGACATTCTCCTGCGAGGTAACTGTGCCTGTGATGTGGGGAGAGTGTGA |
| Protein Length | 19 |
| Start Codon | AGG |
| Location | chr1:246186836-246186896:- |
| Blocks | 246186836-246186896 |
| Mean PhyloCSF | -7.66813325882 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000185420; SMYD3; |
| Mass (Da) | mono. 2119.1; avg. 2120.5 |
Ribosome profiling
| Min Ribo P value | 0.006133 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |       |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs