Specific Information of Small Protein : SPROHSA91159
General Information
Small Protein ID | SPROHSA91159 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | RGFRDILLRGNCACDVGRV* |
RNA Sequence | AGGGGCTTCAGAGACATTCTCCTGCGAGGTAACTGTGCCTGTGATGTGGGGAGAGTGTGA |
Protein Length | 19 |
Start Codon | AGG |
Location | chr1:246186836-246186896:- |
Blocks | 246186836-246186896 |
Mean PhyloCSF | -7.66813325882 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000185420; SMYD3; |
Mass (Da) | mono. 2119.1; avg. 2120.5 |
Ribosome profiling
Min Ribo P value | 0.006133 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs