Specific Information of Small Protein : SPROHSA149385
General Information
Small Protein IDSPROHSA149385
Organismhuman (Homo sapiens)
Small Protein SequenceMTLRGFRDILLRGNCACDVGRV*
RNA SequenceATGACTCTAAGGGGCTTCAGAGACATTCTCCTGCGAGGTAACTGTGCCTGTGATGTGGGGAGAGTGTGA
Protein Length22
Start CodonATG
Locationchr1:246186836-246186905:-
Blocks246186836-246186905
Mean PhyloCSF-7.81153614625
Data SourceRibosome profiling;
Related GenesENSG00000185420; SMYD3;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR4045276ENSG00000185420.19ENST00000391836.3SMYD3protein_coding5'UTR6.088e-06None90159
GSE94613_1ENSG00000185420.19ENST00000391836.3SMYD3protein_coding5'UTR0.002354None90159
GSE94613_2ENSG00000185420.19ENST00000391836.3SMYD3protein_coding5'UTR0.007425None90159
Min Ribo Pvalue6.088e-06
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_1MOLM13acute myeloid leukemiaGSM248105229186125;
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
SRR4045276Meg01 cellsWTGSM228590927681415;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA9115919AGG-246186836-246186896
SPROHSA39246330TTG-246186836-246186929
References
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides