Specific Information of Small Protein : SPROHSA149385
General Information
Small Protein ID | SPROHSA149385 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MTLRGFRDILLRGNCACDVGRV* |
RNA Sequence | ATGACTCTAAGGGGCTTCAGAGACATTCTCCTGCGAGGTAACTGTGCCTGTGATGTGGGGAGAGTGTGA |
Protein Length | 22 |
Start Codon | ATG |
Location | chr1:246186836-246186905:- |
Blocks | 246186836-246186905 |
Mean PhyloCSF | -7.81153614625 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000185420; SMYD3; |
Mass (Da) | mono. 2464.3; avg. 2465.9 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR4045276 | ENSG00000185420.19 | ENST00000391836.3 | SMYD3 | Protein_coding | 5'UTR | 6.088E-06 | None | 90 | 159 | 75 | 257.435926 |
GSE94613_1 | ENSG00000185420.19 | ENST00000391836.3 | SMYD3 | Protein_coding | 5'UTR | 0.002354 | None | 90 | 159 | 43 | 359.981264 |
GSE94613_2 | ENSG00000185420.19 | ENST00000391836.3 | SMYD3 | Protein_coding | 5'UTR | 0.007425 | None | 90 | 159 | 96 | 289.508145 |
Min Ribo P value | 6.088E-06 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_1 | MOLM13 | Acute myeloid leukemia | GSM2481052 | 29186125; |
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA91159 | 19 | AGG | - | 246186836-246186896 |
SPROHSA392463 | 30 | TTG | - | 246186836-246186929 |