SmProt

Specific Information of Small Protein : SPROHSA149385

General Information

Small Protein ID	SPROHSA149385
Organism	Human (Homo sapiens)
Small Protein Sequence	MTLRGFRDILLRGNCACDVGRV*
RNA Sequence	ATGACTCTAAGGGGCTTCAGAGACATTCTCCTGCGAGGTAACTGTGCCTGTGATGTGGGGAGAGTGTGA
Protein Length	22
Start Codon	ATG
Location	chr1:246186836-246186905:-
Blocks	246186836-246186905
Mean PhyloCSF	-7.81153614625
Data Source	Ribosome profiling;
Related Genes	ENSG00000185420; SMYD3;
Mass (Da)	mono. 2464.3; avg. 2465.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR4045276	ENSG00000185420.19	ENST00000391836.3	SMYD3	Protein_coding	5'UTR	6.088E-06	None	90	159	75	257.435926
GSE94613_1	ENSG00000185420.19	ENST00000391836.3	SMYD3	Protein_coding	5'UTR	0.002354	None	90	159	43	359.981264
GSE94613_2	ENSG00000185420.19	ENST00000391836.3	SMYD3	Protein_coding	5'UTR	0.007425	None	90	159	96	289.508145

Min Ribo P value	6.088E-06
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE94613_1	MOLM13	Acute myeloid leukemia	GSM2481052	29186125;
GSE94613_2	MOLM13	Acute myeloid leukemia	GSM2481053	29186125;
SRR4045276	Meg01 cells	WT	GSM2285909	27681415;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
Acute myeloid leukemia	Predicted by Ribo-seq

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA91159	19	AGG	-	246186836-246186896
SPROHSA392463	30	TTG	-	246186836-246186929