Small Protein ID | SPROHSA149385 | ||
Organism | human (Homo sapiens) | ||
Small Protein Sequence | MTLRGFRDILLRGNCACDVGRV* | ||
RNA Sequence | ATGACTCTAAGGGGCTTCAGAGACATTCTCCTGCGAGGTAACTGTGCCTGTGATGTGGGGAGAGTGTGA | ||
Protein Length | 22 | ||
Start Codon | ATG | ||
Location | chr1:246186836-246186905:- | ||
Blocks | 246186836-246186905 | ||
Mean PhyloCSF | -7.81153614625 | ||
Data Source | Ribosome profiling; | ||
Related Genes | ENSG00000185420; SMYD3; |
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|---|---|---|---|---|---|---|---|---|
SRR4045276 | ENSG00000185420.19 | ENST00000391836.3 | SMYD3 | protein_coding | 5'UTR | 6.088e-06 | None | 90 | 159 |
GSE94613_1 | ENSG00000185420.19 | ENST00000391836.3 | SMYD3 | protein_coding | 5'UTR | 0.002354 | None | 90 | 159 |
GSE94613_2 | ENSG00000185420.19 | ENST00000391836.3 | SMYD3 | protein_coding | 5'UTR | 0.007425 | None | 90 | 159 |
Min Ribo Pvalue | 6.088e-06 |
Min TIS Pvalue | None |
No results |
No results |
No results |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|---|---|---|---|---|---|---|---|---|---|
No results |
Disease | Detected |
---|---|
acute myeloid leukemia | PredictedByRibo |
VarID | Consequence To sORF | rsID | RiboID |
---|---|---|---|
No results |
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|---|---|---|---|
SPROHSA91159 | 19 | AGG | - | 246186836-246186896 |
SPROHSA392463 | 30 | TTG | - | 246186836-246186929 |
PMID | 27681415 |
Title | Dynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets |
Journal | Cell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088. |
Authors | Eric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia |
PMID | 29186125 |
Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |