Specific Information of Small Protein : SPROHSA88936
General Information
Small Protein ID | SPROHSA88936 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | RAGFLG* |
RNA Sequence | AGGGCGGGCTTTCTAGGATGA |
Protein Length | 6 |
Start Codon | AGG |
Location | chr3:122359764-122359785:- |
Blocks | 122359764-122359785 |
Mean PhyloCSF | -8.49966655459 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000160124; CCDC58; |
Mass (Da) | mono. 619.3; avg. 619.7 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE94613_2_alt | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | Protein_coding | 3'UTR | 0.005848 | None | 252 | 273 | 5 | 49.5438046 |
GSE94613_2_alt | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | Protein_coding | Novel | 0.005848 | None | 433 | 454 | 5 | 49.5438046 |
GSE94613_2_alt | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | Protein_coding | 3'UTR | 0.005848 | None | 525 | 546 | 5 | 49.5438046 |
GSE94613_2_alt | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | Protein_coding | Novel | 0.005848 | None | 612 | 633 | 5 | 49.5438046 |
Min Ribo P value | 0.005848 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA146050 | 11 | ATG | - | 122359764-122359800 |