Specific Information of Small Protein : SPROHSA146050
General Information
Small Protein IDSPROHSA146050
Organismhuman (Homo sapiens)
Small Protein SequenceMTDINRAGFLG*
RNA SequenceATGACAGATATCAACAGGGCGGGCTTTCTAGGATGA
Protein Length11
Start CodonATG
Locationchr3:122359764-122359800:-
Blocks122359764-122359800
Mean PhyloCSF-8.23024992148
Data SourceRibosome profiling;
Related GenesENSG00000160124; CCDC58;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000160124.9ENST00000497726.5CCDC58protein_coding3'UTR0.008403None237273
SRR7207252ENSG00000160124.9ENST00000497726.5CCDC58protein_coding3'UTR0.030812None237273
SRR7207252_altENSG00000160124.9ENST00000497726.5CCDC58protein_coding3'UTR0.030812None237273
GSE94613_2ENSG00000160124.9ENST00000460810.1CCDC58protein_codingNovel0.008403None418454
SRR7207252ENSG00000160124.9ENST00000460810.1CCDC58protein_codingNovel0.030812None418454
SRR7207252_altENSG00000160124.9ENST00000460810.1CCDC58protein_codingNovel0.030812None418454
GSE94613_2ENSG00000160124.9ENST00000291458.9CCDC58protein_coding3'UTR0.008403None510546
SRR7207252ENSG00000160124.9ENST00000291458.9CCDC58protein_coding3'UTR0.030812None510546
SRR7207252_altENSG00000160124.9ENST00000291458.9CCDC58protein_coding3'UTR0.030812None510546
GSE94613_2ENSG00000160124.9ENST00000466854.5CCDC58protein_codingNovel0.008403None597633
SRR7207252ENSG00000160124.9ENST00000466854.5CCDC58protein_codingNovel0.030812None597633
SRR7207252_altENSG00000160124.9ENST00000466854.5CCDC58protein_codingNovel0.030812None597633
Min Ribo Pvalue0.008403
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
SRR7207252MCF10A-ER-Srcbreast adenocarcinomaGSM315026530089253;
SRR7207252_altMCF10A-ER-Srcbreast adenocarcinomaGSM315026530089253;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA889366AGG-122359764-122359785
References
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides
PMID30089253
TitleNutrient Deprivation Elicits a Transcriptional and Translational Inflammatory Response Coupled to Decreased Protein Synthesis
JournalCell Rep.2018 Aug 7;24(6):1415-1424.doi: 10.1016/j.celrep.2018.07.021.
AuthorsPaulo A Gameiro,Kevin Struhl