Small Protein ID | SPROHSA146050 | ||
Organism | human (Homo sapiens) | ||
Small Protein Sequence | MTDINRAGFLG* | ||
RNA Sequence | ATGACAGATATCAACAGGGCGGGCTTTCTAGGATGA | ||
Protein Length | 11 | ||
Start Codon | ATG | ||
Location | chr3:122359764-122359800:- | ||
Blocks | 122359764-122359800 | ||
Mean PhyloCSF | -8.23024992148 | ||
Data Source | Ribosome profiling; | ||
Related Genes | ENSG00000160124; CCDC58; |
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|---|---|---|---|---|---|---|---|---|
GSE94613_2 | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | protein_coding | 3'UTR | 0.008403 | None | 237 | 273 |
SRR7207252 | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 237 | 273 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 237 | 273 |
GSE94613_2 | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | protein_coding | Novel | 0.008403 | None | 418 | 454 |
SRR7207252 | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | protein_coding | Novel | 0.030812 | None | 418 | 454 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | protein_coding | Novel | 0.030812 | None | 418 | 454 |
GSE94613_2 | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | protein_coding | 3'UTR | 0.008403 | None | 510 | 546 |
SRR7207252 | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 510 | 546 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 510 | 546 |
GSE94613_2 | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | protein_coding | Novel | 0.008403 | None | 597 | 633 |
SRR7207252 | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | protein_coding | Novel | 0.030812 | None | 597 | 633 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | protein_coding | Novel | 0.030812 | None | 597 | 633 |
Min Ribo Pvalue | 0.008403 |
Min TIS Pvalue | None |
No results |
No results |
No results |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|---|---|---|---|---|---|---|---|---|---|
No results |
Disease | Detected |
---|---|
acute myeloid leukemia | PredictedByRibo |
VarID | Consequence To sORF | rsID | RiboID |
---|---|---|---|
No results |
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|---|---|---|---|
SPROHSA88936 | 6 | AGG | - | 122359764-122359785 |
PMID | 29186125 |
Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |
PMID | 30089253 |
Title | Nutrient Deprivation Elicits a Transcriptional and Translational Inflammatory Response Coupled to Decreased Protein Synthesis |
Journal | Cell Rep.2018 Aug 7;24(6):1415-1424.doi: 10.1016/j.celrep.2018.07.021. |
Authors | Paulo A Gameiro,Kevin Struhl |