Specific Information of Small Protein : SPROHSA146050
General Information
Small Protein ID | SPROHSA146050 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MTDINRAGFLG* |
RNA Sequence | ATGACAGATATCAACAGGGCGGGCTTTCTAGGATGA |
Protein Length | 11 |
Start Codon | ATG |
Location | chr3:122359764-122359800:- |
Blocks | 122359764-122359800 |
Mean PhyloCSF | -8.23024992148 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000160124; CCDC58; |
Mass (Da) | mono. 1193.6; avg. 1194.4 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE94613_2 | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | Protein_coding | 3'UTR | 0.008403 | None | 237 | 273 | 5 | 28.9005526 |
SRR7207252 | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | Protein_coding | 3'UTR | 0.030812 | None | 237 | 273 | 3 | 22.0378040 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | Protein_coding | 3'UTR | 0.030812 | None | 237 | 273 | 3 | 22.0378040 |
GSE94613_2 | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | Protein_coding | Novel | 0.008403 | None | 418 | 454 | 5 | 28.9005526 |
SRR7207252 | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | Protein_coding | Novel | 0.030812 | None | 418 | 454 | 3 | 22.0378040 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | Protein_coding | Novel | 0.030812 | None | 418 | 454 | 3 | 22.0378040 |
GSE94613_2 | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | Protein_coding | 3'UTR | 0.008403 | None | 510 | 546 | 5 | 28.9005526 |
SRR7207252 | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | Protein_coding | 3'UTR | 0.030812 | None | 510 | 546 | 3 | 22.0378040 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | Protein_coding | 3'UTR | 0.030812 | None | 510 | 546 | 3 | 22.0378040 |
GSE94613_2 | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | Protein_coding | Novel | 0.008403 | None | 597 | 633 | 5 | 28.9005526 |
SRR7207252 | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | Protein_coding | Novel | 0.030812 | None | 597 | 633 | 3 | 22.0378040 |
SRR7207252_alt | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | Protein_coding | Novel | 0.030812 | None | 597 | 633 | 3 | 22.0378040 |
Min Ribo P value | 0.008403 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
SRR7207252 | MCF10A-ER-Src | Breast adenocarcinoma | GSM3150265 | 30089253; |
SRR7207252_alt | MCF10A-ER-Src | Breast adenocarcinoma | GSM3150265 | 30089253; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA88936 | 6 | AGG | - | 122359764-122359785 |