Specific Information of Small Protein : SPROHSA146050
General Information
| Small Protein ID | SPROHSA146050 | ||
| Organism | human (Homo sapiens) | ||
| Small Protein Sequence | MTDINRAGFLG* | ||
| RNA Sequence | ATGACAGATATCAACAGGGCGGGCTTTCTAGGATGA | ||
| Protein Length | 11 | ||
| Start Codon | ATG | ||
| Location | chr3:122359764-122359800:- | ||
| Blocks | 122359764-122359800 | ||
| Mean PhyloCSF | -8.23024992148 | ||
| Data Source | Ribosome profiling; | ||
| Related Genes | ENSG00000160124; CCDC58; | ||
Ribosome profiling
| RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
|---|---|---|---|---|---|---|---|---|---|
| GSE94613_2 | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | protein_coding | 3'UTR | 0.008403 | None | 237 | 273 |
| SRR7207252 | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 237 | 273 |
| SRR7207252_alt | ENSG00000160124.9 | ENST00000497726.5 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 237 | 273 |
| GSE94613_2 | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | protein_coding | Novel | 0.008403 | None | 418 | 454 |
| SRR7207252 | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | protein_coding | Novel | 0.030812 | None | 418 | 454 |
| SRR7207252_alt | ENSG00000160124.9 | ENST00000460810.1 | CCDC58 | protein_coding | Novel | 0.030812 | None | 418 | 454 |
| GSE94613_2 | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | protein_coding | 3'UTR | 0.008403 | None | 510 | 546 |
| SRR7207252 | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 510 | 546 |
| SRR7207252_alt | ENSG00000160124.9 | ENST00000291458.9 | CCDC58 | protein_coding | 3'UTR | 0.030812 | None | 510 | 546 |
| GSE94613_2 | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | protein_coding | Novel | 0.008403 | None | 597 | 633 |
| SRR7207252 | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | protein_coding | Novel | 0.030812 | None | 597 | 633 |
| SRR7207252_alt | ENSG00000160124.9 | ENST00000466854.5 | CCDC58 | protein_coding | Novel | 0.030812 | None | 597 | 633 |
| Min Ribo Pvalue | 0.008403 |
| Min TIS Pvalue | None |
Database information
| No results |
Literature information
| No results |
Mass Spectrometry Information
| No results |
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|---|---|---|---|---|---|---|---|---|---|
| No results | ||||||||||
| Disease | Detected |
|---|---|
| acute myeloid leukemia | PredictedByRibo |
Related Variants
| VarID | Consequence To sORF | rsID | RiboID |
|---|---|---|---|
| No results | |||
Related Small Proteins with Different TISs
| ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|---|---|---|---|
| SPROHSA88936 | 6 | AGG | - | 122359764-122359785 |
References
| PMID | 29186125 |
| Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
| Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
| Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |
| PMID | 30089253 |
| Title | Nutrient Deprivation Elicits a Transcriptional and Translational Inflammatory Response Coupled to Decreased Protein Synthesis |
| Journal | Cell Rep.2018 Aug 7;24(6):1415-1424.doi: 10.1016/j.celrep.2018.07.021. |
| Authors | Paulo A Gameiro,Kevin Struhl |