SmProt

Specific Information of Small Protein : SPROHSA70724

General Information

Small Protein ID	SPROHSA70724
Organism	Human (Homo sapiens)
Small Protein Sequence	RSGAGPREARGCPSAGRAMTPAALSCRLVAAAPRARPPPPPPPAPGRASRASGAAPQ*
RNA Sequence	AGGAGCGGGGCGGGACCGCGGGAGGCGCGCGGCTGCCCGAGCGCCGGCCGGGCCATGACCCCCGCTGCTCTGTCTTGCAGGCTCGTCGCCGCGGCCCCCCGAGCCCGACCGCCGCCGCCACCACCACCAGCGCCCGGGCGGGCCTCGCGCGCCTCGGGCGCGGCTCCGCAGTGA
Protein Length	57
Start Codon	AGG
Location	chr16:85750944-85751118:-
Blocks	85750944-85751118
Mean PhyloCSF	-4.40352297865
Data Source	Ribosome profiling;
Related Genes	ENSG00000154102; C16orf74; NONHSAG072323;
Mass (Da)	mono. 5547.9; avg. 5551.3

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE94613_2_alt	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.005365	None	11	185	25	29.8971234

Min Ribo P value	0.005365
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE94613_2_alt	MOLM13	Acute myeloid leukemia	GSM2481053	29186125;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match
MobiDBLite	mobidb-lite	consensus disorder prediction	30	57	-	T
MobiDBLite	mobidb-lite	consensus disorder prediction	1	20	-	T
MobiDBLite	mobidb-lite	consensus disorder prediction	33	47	-	T

Disease	Detected
Acute myeloid leukemia	Predicted by Ribo-seq

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA147470	39	ATG	-	85750944-85751064