Specific Information of Small Protein : SPROHSA147470
General Information
Small Protein IDSPROHSA147470
Organismhuman (Homo sapiens)
Small Protein SequenceMTPAALSCRLVAAAPRARPPPPPPPAPGRASRASGAAPQ*
RNA SequenceATGACCCCCGCTGCTCTGTCTTGCAGGCTCGTCGCCGCGGCCCCCCGAGCCCGACCGCCGCCGCCACCACCACCAGCGCCCGGGCGGGCCTCGCGCGCCTCGGGCGCGGCTCCGCAGTGA
Protein Length39
Start CodonATG
Locationchr16:85750944-85751064:-
Blocks85750944-85751064
Mean PhyloCSF-5.45979165435
Data SourceRibosome profiling; Literature;
Related GenesENSG00000154102; C16orf74; NONHSAG072323;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.006482None32152
GSE94613_2_altENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.006482None32152
SRR7207252ENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.006199None32152
SRR7207252_altENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.006199None32152
GSE83493ENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.013949None32152
GSE83493_altENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.013949None32152
SRR5350744ENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.03518None32152
SRR5350744_altENSG00000154102.11ENST00000284245.9C16orf74protein_coding5'UTR0.03518None32152
GSE94613_2ENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.006482None41161
GSE94613_2_altENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.006482None41161
SRR7207252ENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.006199None41161
SRR7207252_altENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.006199None41161
GSE83493ENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.013949None41161
GSE83493_altENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.013949None41161
SRR5350744ENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.03518None41161
SRR5350744_altENSG00000154102.11ENST00000602914.1C16orf74protein_coding5'UTR0.03518None41161
GSE94613_2ENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.006482None48168
GSE94613_2_altENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.006482None48168
SRR7207252ENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.006199None48168
SRR7207252_altENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.006199None48168
GSE83493ENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.013949None48168
GSE83493_altENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.013949None48168
SRR5350744ENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.03518None48168
SRR5350744_altENSG00000154102.11ENST00000602766.1C16orf74protein_coding5'UTR0.03518None48168
GSE94613_2ENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.006482None65185
SRR7207252ENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.006199None65185
SRR7207252_altENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.006199None65185
GSE83493ENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.013949None65185
GSE83493_altENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.013949None65185
SRR5350744ENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.03518None65185
SRR5350744_altENSG00000154102.11ENST00000602719.5C16orf74protein_coding5'UTR0.03518None65185
Min Ribo Pvalue0.006199
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE83493HeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;
GSE83493_altHeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;
SRR5350744PC9NSCLCGSM253890328388414;
SRR5350744_altPC9NSCLCGSM253890328388414;
SRR7207252MCF10A-ER-Srcbreast adenocarcinomaGSM315026530089253;
SRR7207252_altMCF10A-ER-Srcbreast adenocarcinomaGSM315026530089253;

Database information
No results
Literature information
PMID26687005;
Cell lines Or TissuesBJ
PhenotypeNULL
Gene IDENSG00000154102
Transcript IDENST00000602914
SymbolNA
ORF TypesORF
Gene Typeprotein_coding
ThroughputHigh-throughput Literature Mining
InteractionNA
Function DescriptionNA
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
MobiDBLitemobidb-liteconsensus disorder prediction1239-T
MobiDBLitemobidb-liteconsensus disorder prediction1529-T
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA7072457AGG-85750944-85751118
References
PMID26687005
Title"Many lncRNAs, 5'UTRs, and pseudogenes are translated and some are likely to express functional proteins."
JournalElife. 2015 Dec 19;4:e08890. doi: 10.7554/eLife.08890.
Authors"Ji Z, Song R, Regev A, Struhl K."
PMID28388414
TitleTranscription Impacts the Efficiency of mRNA Translation via Co-transcriptional N6-adenosine Methylation
JournalCell.2017 Apr 6;169(2):326-337.e12.doi: 10.1016/j.cell.2017.03.031.
AuthorsBoris Slobodin,Ruiqi Han,Vittorio Calderone,Joachim A F Oude Vrielink,Fabricio Loayza-Puch,Ran Elkon,Reuven Agami
PMID28460002
TitleProteomic analysis of polyribosomes identifies splicing factors as potential regulators of translation during mitosis
JournalNucleic Acids Res.2017 Jun 2;45(10):5945-5957.doi: 10.1093/nar/gkx326.
AuthorsRanen Aviner,Sarah Hofmann,Tamar Elman,Anjana Shenoy,Tamar Geiger,Ran Elkon,Marcelo Ehrlich,Orna Elroy-Stein
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides
PMID30089253
TitleNutrient Deprivation Elicits a Transcriptional and Translational Inflammatory Response Coupled to Decreased Protein Synthesis
JournalCell Rep.2018 Aug 7;24(6):1415-1424.doi: 10.1016/j.celrep.2018.07.021.
AuthorsPaulo A Gameiro,Kevin Struhl