SmProt

Specific Information of Small Protein : SPROHSA147470

General Information

Small Protein ID	SPROHSA147470
Organism	Human (Homo sapiens)
Small Protein Sequence	MTPAALSCRLVAAAPRARPPPPPPPAPGRASRASGAAPQ*
RNA Sequence	ATGACCCCCGCTGCTCTGTCTTGCAGGCTCGTCGCCGCGGCCCCCCGAGCCCGACCGCCGCCGCCACCACCACCAGCGCCCGGGCGGGCCTCGCGCGCCTCGGGCGCGGCTCCGCAGTGA
Protein Length	39
Start Codon	ATG
Location	chr16:85750944-85751064:-
Blocks	85750944-85751064
Mean PhyloCSF	-5.45979165435
Data Source	Ribosome profiling; Literature;
Related Genes	ENSG00000154102; C16orf74; NONHSAG072323;
Mass (Da)	mono. 3811; avg. 3813.4

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE94613_2	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.006482	None	32	152	25	43.3508290
GSE94613_2_alt	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.006482	None	32	152	25	43.3508290
SRR7207252	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.006199	None	32	152	13	28.6491452
SRR7207252_alt	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.006199	None	32	152	13	28.6491452
GSE83493	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.013949	None	32	152	41	40.9455947
GSE83493_alt	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.013949	None	32	152	41	40.9455947
SRR5350744	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.03518	None	32	152	3	9.72855010
SRR5350744_alt	ENSG00000154102.11	ENST00000284245.9	C16orf74	Protein_coding	5'UTR	0.03518	None	32	152	3	9.72855010
GSE94613_2	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.006482	None	41	161	25	43.3508290
GSE94613_2_alt	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.006482	None	41	161	25	43.3508290
SRR7207252	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.006199	None	41	161	13	28.6491452
SRR7207252_alt	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.006199	None	41	161	13	28.6491452
GSE83493	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.013949	None	41	161	41	40.9455947
GSE83493_alt	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.013949	None	41	161	41	40.9455947
SRR5350744	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.03518	None	41	161	3	9.72855010
SRR5350744_alt	ENSG00000154102.11	ENST00000602914.1	C16orf74	Protein_coding	5'UTR	0.03518	None	41	161	3	9.72855010
GSE94613_2	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.006482	None	48	168	25	43.3508290
GSE94613_2_alt	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.006482	None	48	168	25	43.3508290
SRR7207252	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.006199	None	48	168	13	28.6491452
SRR7207252_alt	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.006199	None	48	168	13	28.6491452
GSE83493	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.013949	None	48	168	41	40.9455947
GSE83493_alt	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.013949	None	48	168	41	40.9455947
SRR5350744	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.03518	None	48	168	3	9.72855010
SRR5350744_alt	ENSG00000154102.11	ENST00000602766.1	C16orf74	Protein_coding	5'UTR	0.03518	None	48	168	3	9.72855010
GSE94613_2	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.006482	None	65	185	25	43.3508290
SRR7207252	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.006199	None	65	185	13	28.6491452
SRR7207252_alt	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.006199	None	65	185	13	28.6491452
GSE83493	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.013949	None	65	185	41	40.9455947
GSE83493_alt	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.013949	None	65	185	41	40.9455947
SRR5350744	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.03518	None	65	185	3	9.72855010
SRR5350744_alt	ENSG00000154102.11	ENST00000602719.5	C16orf74	Protein_coding	5'UTR	0.03518	None	65	185	3	9.72855010

Min Ribo P value	0.006199
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE83493	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;
GSE83493_alt	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;
GSE94613_2	MOLM13	Acute myeloid leukemia	GSM2481053	29186125;
GSE94613_2_alt	MOLM13	Acute myeloid leukemia	GSM2481053	29186125;
SRR5350744	PC9	NSCLC	GSM2538903	28388414;
SRR5350744_alt	PC9	NSCLC	GSM2538903	28388414;
SRR7207252	MCF10A-ER-Src	Breast adenocarcinoma	GSM3150265	30089253;
SRR7207252_alt	MCF10A-ER-Src	Breast adenocarcinoma	GSM3150265	30089253;

Database information

No results

Literature information

PMID	26687005;
Cell lines Or Tissues	BJ
Phenotype	NULL
Gene ID	ENSG00000154102
Transcript ID	ENST00000602914
Symbol	NA
ORF Type	sORF
Gene Type	protein_coding
Throughput	High-throughput Literature Mining
Interaction	NA
Function Description	NA

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
MobiDBLite	mobidb-lite	consensus disorder prediction	12	39	-	T
MobiDBLite	mobidb-lite	consensus disorder prediction	15	29	-	T

Disease	Detected
Acute myeloid leukemia	Predicted by Ribo-seq

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA70724	57	AGG	-	85750944-85751118

a reliable repository with comprehensive annotation of small proteins derived from ribosome profiling