Small Protein ID | SPROHSA147470 | ||
Organism | human (Homo sapiens) | ||
Small Protein Sequence | MTPAALSCRLVAAAPRARPPPPPPPAPGRASRASGAAPQ* | ||
RNA Sequence | ATGACCCCCGCTGCTCTGTCTTGCAGGCTCGTCGCCGCGGCCCCCCGAGCCCGACCGCCGCCGCCACCACCACCAGCGCCCGGGCGGGCCTCGCGCGCCTCGGGCGCGGCTCCGCAGTGA | ||
Protein Length | 39 | ||
Start Codon | ATG | ||
Location | chr16:85750944-85751064:- | ||
Blocks | 85750944-85751064 | ||
Mean PhyloCSF | -5.45979165435 | ||
Data Source | Ribosome profiling; Literature; | ||
Related Genes | ENSG00000154102; C16orf74; NONHSAG072323; |
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|---|---|---|---|---|---|---|---|---|
GSE94613_2 | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 32 | 152 |
GSE94613_2_alt | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 32 | 152 |
SRR7207252 | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 32 | 152 |
SRR7207252_alt | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 32 | 152 |
GSE83493 | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 32 | 152 |
GSE83493_alt | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 32 | 152 |
SRR5350744 | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 32 | 152 |
SRR5350744_alt | ENSG00000154102.11 | ENST00000284245.9 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 32 | 152 |
GSE94613_2 | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 41 | 161 |
GSE94613_2_alt | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 41 | 161 |
SRR7207252 | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 41 | 161 |
SRR7207252_alt | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 41 | 161 |
GSE83493 | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 41 | 161 |
GSE83493_alt | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 41 | 161 |
SRR5350744 | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 41 | 161 |
SRR5350744_alt | ENSG00000154102.11 | ENST00000602914.1 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 41 | 161 |
GSE94613_2 | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 48 | 168 |
GSE94613_2_alt | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 48 | 168 |
SRR7207252 | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 48 | 168 |
SRR7207252_alt | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 48 | 168 |
GSE83493 | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 48 | 168 |
GSE83493_alt | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 48 | 168 |
SRR5350744 | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 48 | 168 |
SRR5350744_alt | ENSG00000154102.11 | ENST00000602766.1 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 48 | 168 |
GSE94613_2 | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.006482 | None | 65 | 185 |
SRR7207252 | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 65 | 185 |
SRR7207252_alt | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.006199 | None | 65 | 185 |
GSE83493 | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 65 | 185 |
GSE83493_alt | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.013949 | None | 65 | 185 |
SRR5350744 | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 65 | 185 |
SRR5350744_alt | ENSG00000154102.11 | ENST00000602719.5 | C16orf74 | protein_coding | 5'UTR | 0.03518 | None | 65 | 185 |
Min Ribo Pvalue | 0.006199 |
Min TIS Pvalue | None |
RiboID | CellORTissue | Phenotype | RiboSource | PMID |
---|---|---|---|---|
GSE83493 | HeLa S3 | cervical cancer | GSM2204389;GSM2204390;GSM2204391;GSM2204392 | 28460002; |
GSE83493_alt | HeLa S3 | cervical cancer | GSM2204389;GSM2204390;GSM2204391;GSM2204392 | 28460002; |
GSE94613_2 | MOLM13 | acute myeloid leukemia | GSM2481053 | 29186125; |
GSE94613_2_alt | MOLM13 | acute myeloid leukemia | GSM2481053 | 29186125; |
SRR5350744 | PC9 | NSCLC | GSM2538903 | 28388414; |
SRR5350744_alt | PC9 | NSCLC | GSM2538903 | 28388414; |
SRR7207252 | MCF10A-ER-Src | breast adenocarcinoma | GSM3150265 | 30089253; |
SRR7207252_alt | MCF10A-ER-Src | breast adenocarcinoma | GSM3150265 | 30089253; |
No results |
PMID | 26687005; |
Cell lines Or Tissues | BJ |
Phenotype | NULL |
Gene ID | ENSG00000154102 |
Transcript ID | ENST00000602914 |
Symbol | NA |
ORF Type | sORF |
Gene Type | protein_coding |
Throughput | High-throughput Literature Mining |
Interaction | NA |
Function Description | NA |
No results |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|---|---|---|---|---|---|---|---|---|---|
MobiDBLite | mobidb-lite | consensus disorder prediction | 12 | 39 | - | T | ||||
MobiDBLite | mobidb-lite | consensus disorder prediction | 15 | 29 | - | T |
Disease | Detected |
---|---|
acute myeloid leukemia | PredictedByRibo |
VarID | Consequence To sORF | rsID | RiboID |
---|---|---|---|
No results |
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|---|---|---|---|
SPROHSA70724 | 57 | AGG | - | 85750944-85751118 |
PMID | 26687005 |
Title | "Many lncRNAs, 5'UTRs, and pseudogenes are translated and some are likely to express functional proteins." |
Journal | Elife. 2015 Dec 19;4:e08890. doi: 10.7554/eLife.08890. |
Authors | "Ji Z, Song R, Regev A, Struhl K." |
PMID | 28388414 |
Title | Transcription Impacts the Efficiency of mRNA Translation via Co-transcriptional N6-adenosine Methylation |
Journal | Cell.2017 Apr 6;169(2):326-337.e12.doi: 10.1016/j.cell.2017.03.031. |
Authors | Boris Slobodin,Ruiqi Han,Vittorio Calderone,Joachim A F Oude Vrielink,Fabricio Loayza-Puch,Ran Elkon,Reuven Agami |
PMID | 28460002 |
Title | Proteomic analysis of polyribosomes identifies splicing factors as potential regulators of translation during mitosis |
Journal | Nucleic Acids Res.2017 Jun 2;45(10):5945-5957.doi: 10.1093/nar/gkx326. |
Authors | Ranen Aviner,Sarah Hofmann,Tamar Elman,Anjana Shenoy,Tamar Geiger,Ran Elkon,Marcelo Ehrlich,Orna Elroy-Stein |
PMID | 29186125 |
Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |
PMID | 30089253 |
Title | Nutrient Deprivation Elicits a Transcriptional and Translational Inflammatory Response Coupled to Decreased Protein Synthesis |
Journal | Cell Rep.2018 Aug 7;24(6):1415-1424.doi: 10.1016/j.celrep.2018.07.021. |
Authors | Paulo A Gameiro,Kevin Struhl |