Specific Information of Small Protein : SPROHSA67636
General Information
Small Protein ID | SPROHSA67636 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | RTRRPGRSPFPERTAL* |
RNA Sequence | AGGACGCGCAGACCGGGCCGCAGCCCATTCCCCGAGCGGACTGCATTATGA |
Protein Length | 16 |
Start Codon | AGG |
Location | chr9:76394167-76394218:- |
Blocks | 76394167-76394218 |
Mean PhyloCSF | -7.61541168362 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000135002; RFK; |
Mass (Da) | mono. 1896.1; avg. 1897.1 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45833_5_alt | ENSG00000135002.12 | ENST00000376736.6 | RFK | Protein_coding | 5'UTR | 0.033787 | None | 208 | 259 | 5 | 37.7873690 |
GSE45833_5_alt | ENSG00000135002.12 | ENST00000472900.5 | RFK | Protein_coding | Novel | 0.033787 | None | 299 | 350 | 5 | 37.7873690 |
GSE45833_5_alt | ENSG00000135002.12 | ENST00000479197.1 | RFK | Protein_coding | Novel | 0.033787 | None | 299 | 350 | 5 | 37.7873690 |
Min Ribo P value | 0.033787 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
9-76394190-A-C | Non-Synonymous p.F10C | rs2490582 | SRR2818787; SRR2818791; SRR3208885; SRR3208921; SRR3317843; SRR3575897; SRR4045276; SRR4450331; SRR4450332; SRR5047770; SRR5047771; SRR5047772; SRR5227294; SRR5239056; SRR5239057; SRR5350744; SRR5350745; SRR5382423; SRR5382424; SRR5512738; SRR6053333; SRR6053334; SRR6838651; SRR7207252; SRR8907185; SRR8907187; SRR8310197; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR6181539; SRR6181540; SRR6181541; SRR3680966; SRR3680967; SRR3680968; SRR3680969; SRR1333393; SRR1333394; SRR627622; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR1795426; SRR1795427; SRR1795428; SRR618771 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA51610 | 35 | ACG | - | 76394167-76394275 |