Specific Information of Small Protein : SPROHSA51610
General Information
| Small Protein ID | SPROHSA51610 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | TLLSPGWSGVWAPRRRRLRRTRRPGRSPFPERTAL* |
| RNA Sequence | ACGCTCCTGTCCCCCGGCTGGTCCGGGGTCTGGGCGCCGCGTCGACGGCGGCTCCGCAGGACGCGCAGACCGGGCCGCAGCCCATTCCCCGAGCGGACTGCATTATGA |
| Protein Length | 35 |
| Start Codon | ACG |
| Location | chr9:76394167-76394275:- |
| Blocks | 76394167-76394275 |
| Mean PhyloCSF | -7.71998148494 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000135002; RFK; |
| Mass (Da) | mono. 4141.3; avg. 4143.8 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR5350745_alt | ENSG00000135002.12 | ENST00000376736.6 | RFK | Protein_coding | 5'UTR | 0.037858 | None | 151 | 259 | 8 | 43.5522333 |
| SRR5350745_alt | ENSG00000135002.12 | ENST00000472900.5 | RFK | Protein_coding | Novel | 0.037858 | None | 242 | 350 | 8 | 43.5522333 |
| SRR5350745_alt | ENSG00000135002.12 | ENST00000479197.1 | RFK | Protein_coding | Novel | 0.037858 | None | 242 | 350 | 8 | 43.5522333 |
| Min Ribo P value | 0.037858 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR5350745_alt | H1933 | NSCLC | GSM2538904 | 28388414; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 9-76394190-A-C | Non-Synonymous p.F29C | rs2490582 | SRR2818787; SRR2818791; SRR3208885; SRR3208921; SRR3317843; SRR3575897; SRR4045276; SRR4450331; SRR4450332; SRR5047770; SRR5047771; SRR5047772; SRR5227294; SRR5239056; SRR5239057; SRR5350744; SRR5350745; SRR5382423; SRR5382424; SRR5512738; SRR6053333; SRR6053334; SRR6838651; SRR7207252; SRR8907185; SRR8907187; SRR8310197; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR6181539; SRR6181540; SRR6181541; SRR3680966; SRR3680967; SRR3680968; SRR3680969; SRR1333393; SRR1333394; SRR627622; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR1795426; SRR1795427; SRR1795428; SRR618771 |
| 9-76394223-A-G | Non-Synonymous p.L18P | rs3739729 | SRR2818787; SRR2818791; SRR4045276; SRR4450331; SRR4450332; SRR5047771; SRR5047772; SRR5239056; SRR5239057; SRR6838651; SRR8310197; SRR6181538; SRR6181539; SRR6181540; SRR6181541; SRR3680966; SRR3680967; SRR3680968; SRR3680969; SRR810101 |
| 9-76394227-G-A | Non-Synonymous p.R17W | . | SRR5239056 |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA67636 | 16 | AGG | - | 76394167-76394218 |
SmProt