Specific Information of Small Protein : SPROHSA383766
General Information
| Small Protein ID | SPROHSA383766 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LAEAARTSGQDAWNRTCRRHHRCHHI* |
| RNA Sequence | TTGGCCGAAGCCGCGCGAACCTCAGGGCAAGATGCTTGGAACCGGACCTGCCGCCGCCACCACCGCTGCCACCACATCTAG |
| Protein Length | 26 |
| Start Codon | TTG |
| Location | chr1:11259359-11262461:- |
| Blocks | 11259359-11259423,11262444-11262461 |
| Mean PhyloCSF | 1.94337042026 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000198793; MTOR; |
| Mass (Da) | mono. 3081.5; avg. 3083.4 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45785_5_alt | ENSG00000198793.12 | ENST00000361445.8 | MTOR | Protein_coding | 5'UTR | 0.004266 | None | 46 | 127 | 8 | 102.316319 |
| SRR5350745_alt | ENSG00000198793.12 | ENST00000361445.8 | MTOR | Protein_coding | 5'UTR | 0.005251 | None | 46 | 127 | 11 | 79.8457612 |
| Min Ribo P value | 0.004266 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45785_5_alt | BJ cells | Immortalized | GSM1115216 | 23594524; |
| SRR5350745_alt | H1933 | NSCLC | GSM2538904 | 28388414; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA296236 | 33 | CTG | - | 11259359-11259423, 11262444-11262482 |
SmProt