SmProt

Specific Information of Small Protein : SPROHSA296236

General Information

Small Protein ID	SPROHSA296236
Organism	Human (Homo sapiens)
Small Protein Sequence	LAAAAEALAEAARTSGQDAWNRTCRRHHRCHHI*
RNA Sequence	CTGGCGGCGGCAGCTGAGGCCTTGGCCGAAGCCGCGCGAACCTCAGGGCAAGATGCTTGGAACCGGACCTGCCGCCGCCACCACCGCTGCCACCACATCTAG
Protein Length	33
Start Codon	CTG
Location	chr1:11259359-11262482:-
Blocks	11259359-11259423,11262444-11262482
Mean PhyloCSF	-0.0836274425189
Data Source	Ribosome profiling;
Related Genes	ENSG00000198793; MTOR;
Mass (Da)	mono. 3678.8; avg. 3681.1

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE45785_3_alt	ENSG00000198793.12	ENST00000361445.8	MTOR	Protein_coding	5'UTR	0.002643	None	25	127	21	86.8298170
GSE45785_1_alt	ENSG00000198793.12	ENST00000361445.8	MTOR	Protein_coding	5'UTR	0.012462	None	25	127	15	96.4117847
GSE45785_4_alt	ENSG00000198793.12	ENST00000361445.8	MTOR	Protein_coding	5'UTR	0.018485	None	25	127	22	137.562215

Min Ribo P value	0.002643
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE45785_1_alt	BJ cells	WT	GSM1115204	23594524;
GSE45785_3_alt	BJ cells	Immortalized	GSM1115210	23594524;
GSE45785_4_alt	BJ cells	Immortalized	GSM1115213	23594524;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA383766	26	TTG	-	11259359-11259423, 11262444-11262461