Specific Information of Small Protein : SPROHSA375872
General Information
| Small Protein ID | SPROHSA375872 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LPALQLPYFRRLFS* |
| RNA Sequence | TTGCCTGCGCTACAGCTTCCTTATTTTCGTCGCCTGTTCTCCTGA |
| Protein Length | 14 |
| Start Codon | TTG |
| Location | chr22:45413808-45413853:+ |
| Blocks | 45413808-45413853 |
| Mean PhyloCSF | -6.24766658147 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000128408; RIBC2; |
| Mass (Da) | mono. 1720; avg. 1721.1 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR618770,618771,618772,618773_alt | ENSG00000128408.8 | ENST00000614167.1 | RIBC2 | Protein_coding | 5'UTR | 0.003702 | 0.002859 | 118 | 163 | 12 | 45.0179734 |
| SRR964946_alt | ENSG00000128408.8 | ENST00000614167.1 | RIBC2 | Protein_coding | 5'UTR | 0.031227 | 0.030913 | 118 | 163 | NA | NA |
| Min Ribo P value | 0.003702 |
| Min TIS P value | 0.002859 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770; SRR618771; SRR618772; SRR618773 | NA; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 22-45413817-G-A | Synonymous p.A3A | rs2272805 | SRR5239057; SRR618770; SRR618771 |
Related Small Proteins with Different TISs
SmProt