Specific Information of Small Protein : SPROHSA364811
General Information
Small Protein ID | SPROHSA364811 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | VCQVTEAPESAPALLASRHDPPLPMGPSVCAPSPGD* |
RNA Sequence | GTGTGTCAAGTTACAGAGGCGCCGGAATCGGCCCCTGCGCTCCTCGCCAGCCGCCACGACCCACCTCTGCCCATGGGGCCCTCCGTGTGCGCCCCTTCGCCCGGGGACTGA |
Protein Length | 36 |
Start Codon | GTG |
Location | chr10:69801929-69802040:+ |
Blocks | 69801929-69802040 |
Mean PhyloCSF | -3.99521620854 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000197467; COL13A1; |
Mass (Da) | mono. 3595.7; avg. 3598 |
Ribosome profiling
Min Ribo P value | 0.026281 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45833_2_alt | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
10-69802009-C-A | Non-Synonymous p.P27H | . | SRR5350744 |
10-69802014-G-A | Non-Synonymous p.V29M | rs2704505 | SRR2818787; SRR2818791; SRR5350744; SRR627622; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA205101 | 12 | ATG | + | 69802001-69802040 |