Specific Information of Small Protein : SPROHSA205101
General Information
Small Protein ID | SPROHSA205101 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MGPSVCAPSPGD* |
RNA Sequence | ATGGGGCCCTCCGTGTGCGCCCCTTCGCCCGGGGACTGA |
Protein Length | 12 |
Start Codon | ATG |
Location | chr10:69802001-69802040:+ |
Blocks | 69802001-69802040 |
Mean PhyloCSF | -5.31261541293 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000197467; COL13A1; |
Mass (Da) | mono. 1116.5; avg. 1117.3 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45833_2 | ENSG00000197467.14 | ENST00000645393.1 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 135 | 174 | 6 | 21.1262565 |
GSE45833_2 | ENSG00000197467.14 | ENST00000354547.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
GSE45833_2_alt | ENSG00000197467.14 | ENST00000354547.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
GSE45833_2 | ENSG00000197467.14 | ENST00000357811.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
GSE45833_2_alt | ENSG00000197467.14 | ENST00000357811.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
GSE45833_2 | ENSG00000197467.14 | ENST00000398978.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
GSE45833_2_alt | ENSG00000197467.14 | ENST00000398978.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
GSE45833_2 | ENSG00000197467.14 | ENST00000479733.5 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 71 | 110 | 6 | 21.1262565 |
GSE45833_2_alt | ENSG00000197467.14 | ENST00000479733.5 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 71 | 110 | 6 | 21.1262565 |
Min Ribo P value | 0.031294 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45833_2 | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
GSE45833_2_alt | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
10-69802009-C-A | Non-Synonymous p.P3H | . | SRR5350744 |
10-69802014-G-A | Non-Synonymous p.V5M | rs2704505 | SRR2818787; SRR2818791; SRR5350744; SRR627622; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA364811 | 36 | GTG | + | 69801929-69802040 |