Specific Information of Small Protein : SPROHSA205101
General Information
| Small Protein ID | SPROHSA205101 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MGPSVCAPSPGD* |
| RNA Sequence | ATGGGGCCCTCCGTGTGCGCCCCTTCGCCCGGGGACTGA |
| Protein Length | 12 |
| Start Codon | ATG |
| Location | chr10:69802001-69802040:+ |
| Blocks | 69802001-69802040 |
| Mean PhyloCSF | -5.31261541293 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000197467; COL13A1; |
| Mass (Da) | mono. 1116.5; avg. 1117.3 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45833_2 | ENSG00000197467.14 | ENST00000645393.1 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 135 | 174 | 6 | 21.1262565 |
| GSE45833_2 | ENSG00000197467.14 | ENST00000354547.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
| GSE45833_2_alt | ENSG00000197467.14 | ENST00000354547.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
| GSE45833_2 | ENSG00000197467.14 | ENST00000357811.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
| GSE45833_2_alt | ENSG00000197467.14 | ENST00000357811.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
| GSE45833_2 | ENSG00000197467.14 | ENST00000398978.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
| GSE45833_2_alt | ENSG00000197467.14 | ENST00000398978.7 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 70 | 109 | 6 | 21.1262565 |
| GSE45833_2 | ENSG00000197467.14 | ENST00000479733.5 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 71 | 110 | 6 | 21.1262565 |
| GSE45833_2_alt | ENSG00000197467.14 | ENST00000479733.5 | COL13A1 | Protein_coding | 5'UTR | 0.031294 | None | 71 | 110 | 6 | 21.1262565 |
| Min Ribo P value | 0.031294 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45833_2 | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
| GSE45833_2_alt | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 10-69802009-C-A | Non-Synonymous p.P3H | . | SRR5350744 |
| 10-69802014-G-A | Non-Synonymous p.V5M | rs2704505 | SRR2818787; SRR2818791; SRR5350744; SRR627622; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104 |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA364811 | 36 | GTG | + | 69801929-69802040 |
SmProt