SmProt

Specific Information of Small Protein : SPROHSA337423

General Information

Small Protein ID	SPROHSA337423
Organism	Human (Homo sapiens)
Small Protein Sequence	VLSAHARKPGPDAAVRRTSRRVRLNAASCQAARDALSLRRLLAS*
RNA Sequence	GTGCTCTCAGCTCATGCCCGGAAACCAGGTCCCGACGCCGCGGTCAGACGGACCTCTAGACGCGTCCGCCTCAATGCCGCCAGCTGCCAGGCCGCCCGTGACGCGTTAAGCCTGCGCCGCCTCCTGGCTTCGTGA
Protein Length	44
Start Codon	GTG
Location	chr9:122264731-122264866:+
Blocks	122264731-122264866
Mean PhyloCSF	-5.43404439092
Data Source	Ribosome profiling;
Related Genes	ENSG00000148187; MRRF; ENSG00000119446; RBM18;
Mass (Da)	mono. 4736.7; avg. 4739.4

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE83493_alt	ENSG00000148187.18	ENST00000297908.7	MRRF	Protein_coding	5'UTR	0.023461	None	129	264	9	7.98938434

Min Ribo P value	0.023461
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE83493_alt	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
9-122264840-A-C	Non-Synonymous p.S37R	rs7035313	SRR3680969

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA216137	56	ATG	+	122264695-122264866