Specific Information of Small Protein : SPROHSA337423
General Information
Small Protein ID | SPROHSA337423 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | VLSAHARKPGPDAAVRRTSRRVRLNAASCQAARDALSLRRLLAS* |
RNA Sequence | GTGCTCTCAGCTCATGCCCGGAAACCAGGTCCCGACGCCGCGGTCAGACGGACCTCTAGACGCGTCCGCCTCAATGCCGCCAGCTGCCAGGCCGCCCGTGACGCGTTAAGCCTGCGCCGCCTCCTGGCTTCGTGA |
Protein Length | 44 |
Start Codon | GTG |
Location | chr9:122264731-122264866:+ |
Blocks | 122264731-122264866 |
Mean PhyloCSF | -5.43404439092 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000148187; MRRF; ENSG00000119446; RBM18; |
Mass (Da) | mono. 4736.7; avg. 4739.4 |
Ribosome profiling
Min Ribo P value | 0.023461 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
9-122264840-A-C | Non-Synonymous p.S37R | rs7035313 | SRR3680969 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA216137 | 56 | ATG | + | 122264695-122264866 |