Specific Information of Small Protein : SPROHSA334223
General Information
Small Protein ID | SPROHSA334223 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | VPGAGQFSHQSGDW* |
RNA Sequence | GTGCCTGGAGCTGGGCAGTTTTCTCATCAGAGTGGGGACTGGTAA |
Protein Length | 14 |
Start Codon | GTG |
Location | chr1:778554-778599:- |
Blocks | 778554-778599 |
Mean PhyloCSF | 0 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000230021; AL669831.3; ENSG00000228327; AL669831.1; NONHSAG000046;NONHSAG056042;NONHSAG000041; |
Mass (Da) | mono. 1471.6; avg. 1472.5 |
Ribosome profiling
Min Ribo P value | 0.032065 |
Min TIS P value | 0.002989 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA209417 | 15 | ATG | - | 778554-778602 |