Specific Information of Small Protein : SPROHSA209417
General Information
Small Protein ID | SPROHSA209417 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MVPGAGQFSHQSGDW* |
RNA Sequence | ATGGTGCCTGGAGCTGGGCAGTTTTCTCATCAGAGTGGGGACTGGTAA |
Protein Length | 15 |
Start Codon | ATG |
Location | chr1:778554-778602:- |
Blocks | 778554-778602 |
Mean PhyloCSF | 0 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000230021; AL669831.3; ENSG00000228327; AL669831.1; NONHSAG000046;NONHSAG056042;NONHSAG000041; |
Mass (Da) | mono. 1602.7; avg. 1603.7 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE58207_alt | ENSG00000228327.3 | ENST00000506640.2 | AL669831.1 | Transcribed_unprocessed_pseudogene | Novel | 0.032377 | 0.001379 | 24 | 72 | 3 | 6.43665726 |
GSE94613_2 | ENSG00000228327.3 | ENST00000506640.2 | AL669831.1 | Transcribed_unprocessed_pseudogene | Novel | 0.000653 | None | 24 | 72 | 12 | 52.0209948 |
GSE94613_2_alt | ENSG00000228327.3 | ENST00000506640.2 | AL669831.1 | Transcribed_unprocessed_pseudogene | Novel | 0.000653 | None | 24 | 72 | 12 | 52.0209948 |
Min Ribo P value | 0.000653 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA334223 | 14 | GTG | - | 778554-778599 |