Specific Information of Small Protein : SPROHSA301807
General Information
| Small Protein ID | SPROHSA301807 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LGLLQCEARGLPRRSADRLRAGRREA* |
| RNA Sequence | CTGGGCCTTCTGCAGTGTGAGGCGCGGGGCCTCCCGCGTCGCTCCGCTGACAGGCTGCGGGCGGGCAGGCGGGAGGCGTAG |
| Protein Length | 26 |
| Start Codon | CTG |
| Location | chr8:123768574-123768655:+ |
| Blocks | 123768574-123768655 |
| Mean PhyloCSF | -6.05425925608 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000176853; FAM91A1; |
| Mass (Da) | mono. 2919.6; avg. 2921.3 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE123564_2_alt | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.032742 | None | 119 | 200 | 9 | 15.9283760 |
| GSE123564_2_alt | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.032742 | None | 136 | 217 | 9 | 15.9283760 |
| Min Ribo P value | 0.032742 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE123564_2_alt | Skin fibroblasts: Hbs1L-deficient | Facial dysmorphism, growth restriction and retinal deposits | GSM3507223; GSM3507224; GSM3507225; GSM3507228; GSM3507229; GSM3507230 | 30707697; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 8-123768581-C-T | Non-Synonymous p.L3F | rs142309473 | SRR5350740 |
| 8-123768584-C-A | Non-Synonymous p.L4M | rs12334564 | SRR2818787; SRR2818791; SRR3208885; SRR3208921; SRR3317843; SRR3575897; SRR3575898; SRR4450331; SRR4450332; SRR5047770; SRR5047771; SRR5047772; SRR5227295; SRR5227296; SRR5239050; SRR5239051; SRR5239052; SRR5239056; SRR5239057; SRR5239058; SRR5350740; SRR5350744; SRR5350745; SRR5382423; SRR5382424; SRR6053333; SRR6053334; SRR6838651; SRR7207252; SRR8907185; SRR8310196; SRR8310197; SRR8310198; SRR8310199; SRR8310200; SRR1333393; SRR1333394; SRR627622; SRR627623; SRR627624; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR1795427; SRR1795428; SRR964946; SRR618770 |
| 8-123768587-C-T | Stop Gain p.Q5* | . | SRR8310198 |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA251669 | 37 | CTG | + | 123768541-123768655 |
SmProt