Specific Information of Small Protein : SPROHSA251669
General Information
Small Protein ID | SPROHSA251669 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LNCREPRPWGSLGLLQCEARGLPRRSADRLRAGRREA* |
RNA Sequence | CTGAACTGTCGGGAGCCTAGGCCATGGGGCAGCCTGGGCCTTCTGCAGTGTGAGGCGCGGGGCCTCCCGCGTCGCTCCGCTGACAGGCTGCGGGCGGGCAGGCGGGAGGCGTAG |
Protein Length | 37 |
Start Codon | CTG |
Location | chr8:123768541-123768655:+ |
Blocks | 123768541-123768655 |
Mean PhyloCSF | -5.69855262731 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000176853; FAM91A1; |
Mass (Da) | mono. 4215.2; avg. 4217.8 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45785_4_alt | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.043776 | None | 103 | 217 | 29 | 162.244431 |
GSE45785_4_alt | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.043776 | None | 86 | 200 | 29 | 162.244431 |
Min Ribo P value | 0.043776 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45785_4_alt | BJ cells | Immortalized | GSM1115213 | 23594524; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
8-123768581-C-T | Non-Synonymous p.L14F | rs142309473 | SRR5350740 |
8-123768584-C-A | Non-Synonymous p.L15M | rs12334564 | SRR2818787; SRR2818791; SRR3208885; SRR3208921; SRR3317843; SRR3575897; SRR3575898; SRR4450331; SRR4450332; SRR5047770; SRR5047771; SRR5047772; SRR5227295; SRR5227296; SRR5239050; SRR5239051; SRR5239052; SRR5239056; SRR5239057; SRR5239058; SRR5350740; SRR5350744; SRR5350745; SRR5382423; SRR5382424; SRR6053333; SRR6053334; SRR6838651; SRR7207252; SRR8907185; SRR8310196; SRR8310197; SRR8310198; SRR8310199; SRR8310200; SRR1333393; SRR1333394; SRR627622; SRR627623; SRR627624; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR1795427; SRR1795428; SRR964946; SRR618770 |
8-123768587-C-T | Stop Gain p.Q16* | . | SRR8310198 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA301807 | 26 | CTG | + | 123768574-123768655 |