Specific Information of Small Protein : SPROHSA296027
General Information
Small Protein ID | SPROHSA296027 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LAEEGSPAFLGTERSRVVRG* |
RNA Sequence | CTGGCGGAGGAGGGATCCCCTGCCTTTCTCGGAACGGAACGGAGCAGAGTCGTGCGTGGTTGA |
Protein Length | 20 |
Start Codon | CTG |
Location | chr11:5596705-5596768:+ |
Blocks | 5596705-5596768 |
Mean PhyloCSF | -7.47876187733 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000239920; AC104389.4; ENSG00000258588; TRIM6-TRIM34; ENSG00000121236; TRIM6; NONHSAG007512; |
Mass (Da) | mono. 2130.1; avg. 2131.3 |
Ribosome profiling
Min Ribo P value | 0.038658 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE65778 | HEK293T | WT | GSM1606107; GSM1606108 | 25719440; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
11-5596757-G-A | Non-Synonymous p.V18M | rs12272467 | SRR7182550; SRR618773 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA152824 | 38 | ATG | + | 5596651-5596768 |