SmProt

Specific Information of Small Protein : SPROHSA296027

General Information

Small Protein ID	SPROHSA296027
Organism	Human (Homo sapiens)
Small Protein Sequence	LAEEGSPAFLGTERSRVVRG*
RNA Sequence	CTGGCGGAGGAGGGATCCCCTGCCTTTCTCGGAACGGAACGGAGCAGAGTCGTGCGTGGTTGA
Protein Length	20
Start Codon	CTG
Location	chr11:5596705-5596768:+
Blocks	5596705-5596768
Mean PhyloCSF	-7.47876187733
Data Source	Ribosome profiling;
Related Genes	ENSG00000239920; AC104389.4; ENSG00000258588; TRIM6-TRIM34; ENSG00000121236; TRIM6; NONHSAG007512;
Mass (Da)	mono. 2130.1; avg. 2131.3

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE65778	ENSG00000121236.21	ENST00000511284.5	TRIM6	Protein_coding	Novel	0.038658	None	52	115	4	11.1339794
GSE65778	ENSG00000121236.21	ENST00000380097.8	TRIM6	Protein_coding	5'UTR	0.038658	None	69	132	4	11.1339794

Min Ribo P value	0.038658
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE65778	HEK293T	WT	GSM1606107; GSM1606108	25719440;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
11-5596757-G-A	Non-Synonymous p.V18M	rs12272467	SRR7182550; SRR618773

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA152824	38	ATG	+	5596651-5596768