Specific Information of Small Protein : SPROHSA252331
General Information
Small Protein IDSPROHSA252331
OrganismHuman (Homo sapiens)
Small Protein SequenceLKQRHLGQRKSI*
RNA SequenceCTGAAGCAAAGACATCTGGGTCAGAGAAAAAGTATTTAA
Protein Length12
Start CodonCTG
Locationchr17:59963234-59963273:-
Blocks59963234-59963273
Mean PhyloCSF-7.74061529453
Data SourceRibosome profiling;
Related GenesENSG00000267318; AC005702.1; ENSG00000189050; RNFT1; ENSG00000267104; TBC1D3P1-DHX40P1;
Mass (Da)mono. 1462.9; avg. 1463.7
Ribosome profiling
Ribo-seq IDEnsembl Gene IDEnsembl Transcript IDSymbolGene TypeTIS TypeRibo P valueTIS P valueStart On TransStop On TransIn-frame CountRibo-seq RPKM
GSE94613_2_altENSG00000267104.2ENST00000587125.1TBC1D3P1-DHX40P1LncRNANovel0.003963None1140117922117.380706
Min Ribo P value0.003963
Min TIS P valueNone
Ribo-seq IDCell or TissuePhenotypeRibo-seq Source DetailsPMID
GSE94613_2_altMOLM13Acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
Acute myeloid leukemiaPredicted by Ribo-seq
Related Variants
Variant IDConsequence to sORFrsIDRibo-seq ID
No results
Related Small Proteins with Different TISs
SmProt IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA15152918ATG-59963234-59963284, 59964607-59964614