Specific Information of Small Protein : SPROHSA252331
General Information
Small Protein ID | SPROHSA252331 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LKQRHLGQRKSI* |
RNA Sequence | CTGAAGCAAAGACATCTGGGTCAGAGAAAAAGTATTTAA |
Protein Length | 12 |
Start Codon | CTG |
Location | chr17:59963234-59963273:- |
Blocks | 59963234-59963273 |
Mean PhyloCSF | -7.74061529453 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000267318; AC005702.1; ENSG00000189050; RNFT1; ENSG00000267104; TBC1D3P1-DHX40P1; |
Mass (Da) | mono. 1462.9; avg. 1463.7 |
Ribosome profiling
Min Ribo P value | 0.003963 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA151529 | 18 | ATG | - | 59963234-59963284, 59964607-59964614 |