Specific Information of Small Protein : SPROHSA151529
General Information
| Small Protein ID | SPROHSA151529 | ||
| Organism | human (Homo sapiens) | ||
| Small Protein Sequence | MRGDRGLKQRHLGQRKSI* | ||
| RNA Sequence | ATGAGAGGAGACAGAGGCCTGAAGCAAAGACATCTGGGTCAGAGAAAAAGTATTTAA | ||
| Protein Length | 18 | ||
| Start Codon | ATG | ||
| Location | chr17:59963234-59964614:- | ||
| Blocks | 59963234-59963284,59964607-59964614 | ||
| Mean PhyloCSF | -7.56149115479 | ||
| Data Source | Ribosome profiling; Literature; | ||
| Related Genes | ENSG00000267318; AC005702.1; ENSG00000189050; RNFT1; ENSG00000267104; TBC1D3P1-DHX40P1; | ||
Ribosome profiling
| RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
|---|---|---|---|---|---|---|---|---|---|
| GSE94613_2 | ENSG00000189050.16 | ENST00000482446.5 | RNFT1 | protein_coding | Internal | 0.003206 | None | 120 | 177 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000482446.5 | RNFT1 | protein_coding | Internal | 0.003206 | None | 120 | 177 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000589113.1 | RNFT1 | protein_coding | Internal | 0.003206 | None | 120 | 177 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000589113.1 | RNFT1 | protein_coding | Internal | 0.003206 | None | 120 | 177 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000477207.2 | RNFT1 | protein_coding | Novel | 0.003206 | None | 123 | 180 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000477207.2 | RNFT1 | protein_coding | Novel | 0.003206 | None | 123 | 180 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000305783.13 | RNFT1 | protein_coding | Internal | 0.003206 | None | 126 | 183 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000305783.13 | RNFT1 | protein_coding | Internal | 0.003206 | None | 126 | 183 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000466544.5 | RNFT1 | protein_coding | Internal | 0.003206 | None | 147 | 204 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000466544.5 | RNFT1 | protein_coding | Internal | 0.003206 | None | 147 | 204 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000586083.5 | RNFT1 | protein_coding | Novel | 0.003206 | None | 98 | 155 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000586083.5 | RNFT1 | protein_coding | Novel | 0.003206 | None | 98 | 155 |
| Min Ribo Pvalue | 0.003206 |
| Min TIS Pvalue | None |
Database information
| No results |
Literature information
| PMID | 26687005; |
| Cell lines Or Tissues | BJ |
| Phenotype | NULL |
| Gene ID | ENSG00000189050 |
| Transcript ID | ENST00000589113 |
| Symbol | NA |
| ORF Type | sORF |
| Gene Type | protein_coding |
| Throughput | High-throughput Literature Mining |
| Interaction | NA |
| Function Description | NA |
Mass Spectrometry Information
| No results |
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|---|---|---|---|---|---|---|---|---|---|
| No results | ||||||||||
| Disease | Detected |
|---|---|
| acute myeloid leukemia | PredictedByRibo |
Related Variants
| VarID | Consequence To sORF | rsID | RiboID |
|---|---|---|---|
| No results | |||
Related Small Proteins with Different TISs
| ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|---|---|---|---|
| SPROHSA252331 | 12 | CTG | - | 59963234-59963273 |
References
| PMID | 26687005 |
| Title | "Many lncRNAs, 5'UTRs, and pseudogenes are translated and some are likely to express functional proteins." |
| Journal | Elife. 2015 Dec 19;4:e08890. doi: 10.7554/eLife.08890. |
| Authors | "Ji Z, Song R, Regev A, Struhl K." |
| PMID | 29186125 |
| Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
| Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
| Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |