Specific Information of Small Protein : SPROHSA151529
General Information
Small Protein IDSPROHSA151529
Organismhuman (Homo sapiens)
Small Protein SequenceMRGDRGLKQRHLGQRKSI*
RNA SequenceATGAGAGGAGACAGAGGCCTGAAGCAAAGACATCTGGGTCAGAGAAAAAGTATTTAA
Protein Length18
Start CodonATG
Locationchr17:59963234-59964614:-
Blocks59963234-59963284,59964607-59964614
Mean PhyloCSF-7.56149115479
Data SourceRibosome profiling; Literature;
Related GenesENSG00000267318; AC005702.1; ENSG00000189050; RNFT1; ENSG00000267104; TBC1D3P1-DHX40P1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000189050.16ENST00000482446.5RNFT1protein_codingInternal0.003206None120177
GSE94613_2_altENSG00000189050.16ENST00000482446.5RNFT1protein_codingInternal0.003206None120177
GSE94613_2ENSG00000189050.16ENST00000589113.1RNFT1protein_codingInternal0.003206None120177
GSE94613_2_altENSG00000189050.16ENST00000589113.1RNFT1protein_codingInternal0.003206None120177
GSE94613_2ENSG00000189050.16ENST00000477207.2RNFT1protein_codingNovel0.003206None123180
GSE94613_2_altENSG00000189050.16ENST00000477207.2RNFT1protein_codingNovel0.003206None123180
GSE94613_2ENSG00000189050.16ENST00000305783.13RNFT1protein_codingInternal0.003206None126183
GSE94613_2_altENSG00000189050.16ENST00000305783.13RNFT1protein_codingInternal0.003206None126183
GSE94613_2ENSG00000189050.16ENST00000466544.5RNFT1protein_codingInternal0.003206None147204
GSE94613_2_altENSG00000189050.16ENST00000466544.5RNFT1protein_codingInternal0.003206None147204
GSE94613_2ENSG00000189050.16ENST00000586083.5RNFT1protein_codingNovel0.003206None98155
GSE94613_2_altENSG00000189050.16ENST00000586083.5RNFT1protein_codingNovel0.003206None98155
Min Ribo Pvalue0.003206
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
PMID26687005;
Cell lines Or TissuesBJ
PhenotypeNULL
Gene IDENSG00000189050
Transcript IDENST00000589113
SymbolNA
ORF TypesORF
Gene Typeprotein_coding
ThroughputHigh-throughput Literature Mining
InteractionNA
Function DescriptionNA
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA25233112CTG-59963234-59963273
References
PMID26687005
Title"Many lncRNAs, 5'UTRs, and pseudogenes are translated and some are likely to express functional proteins."
JournalElife. 2015 Dec 19;4:e08890. doi: 10.7554/eLife.08890.
Authors"Ji Z, Song R, Regev A, Struhl K."
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides