Specific Information of Small Protein : SPROHSA151529
General Information
| Small Protein ID | SPROHSA151529 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MRGDRGLKQRHLGQRKSI* |
| RNA Sequence | ATGAGAGGAGACAGAGGCCTGAAGCAAAGACATCTGGGTCAGAGAAAAAGTATTTAA |
| Protein Length | 18 |
| Start Codon | ATG |
| Location | chr17:59963234-59964614:- |
| Blocks | 59963234-59963284,59964607-59964614 |
| Mean PhyloCSF | -7.56149115479 |
| Data Source | Ribosome profiling; Literature; |
| Related Genes | ENSG00000267318; AC005702.1; ENSG00000189050; RNFT1; ENSG00000267104; TBC1D3P1-DHX40P1; |
| Mass (Da) | mono. 2135.2; avg. 2136.5 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE94613_2 | ENSG00000189050.16 | ENST00000482446.5 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 120 | 177 | 25 | 91.2649032 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000482446.5 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 120 | 177 | 25 | 91.2649032 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000589113.1 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 120 | 177 | 25 | 91.2649032 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000589113.1 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 120 | 177 | 25 | 91.2649032 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000477207.2 | RNFT1 | Protein_coding | Novel | 0.003206 | None | 123 | 180 | 25 | 91.2649032 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000477207.2 | RNFT1 | Protein_coding | Novel | 0.003206 | None | 123 | 180 | 25 | 91.2649032 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000305783.13 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 126 | 183 | 25 | 91.2649032 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000305783.13 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 126 | 183 | 25 | 91.2649032 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000466544.5 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 147 | 204 | 25 | 91.2649032 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000466544.5 | RNFT1 | Protein_coding | Internal | 0.003206 | None | 147 | 204 | 25 | 91.2649032 |
| GSE94613_2 | ENSG00000189050.16 | ENST00000586083.5 | RNFT1 | Protein_coding | Novel | 0.003206 | None | 98 | 155 | 25 | 91.2649032 |
| GSE94613_2_alt | ENSG00000189050.16 | ENST00000586083.5 | RNFT1 | Protein_coding | Novel | 0.003206 | None | 98 | 155 | 25 | 91.2649032 |
| Min Ribo P value | 0.003206 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Literature information
| PMID | 26687005; |
| Cell lines Or Tissues | BJ |
| Phenotype | NULL |
| Gene ID | ENSG00000189050 |
| Transcript ID | ENST00000589113 |
| Symbol | NA |
| ORF Type | sORF |
| Gene Type | protein_coding |
| Throughput | High-throughput Literature Mining |
| Interaction | NA |
| Function Description | NA |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA252331 | 12 | CTG | - | 59963234-59963273 |
SmProt