SmProt

Specific Information of Small Protein : SPROHSA230188

General Information

Small Protein ID	SPROHSA230188
Organism	Human (Homo sapiens)
Small Protein Sequence	IQHLEFSCSEKEQEIERLNKLLRQHGLLGEVN*
RNA Sequence	ATTCAACACCTTGAGTTCAGCTGCTCTGAGAAGGAACAAGAAATTGAAAGACTTAACAAACTATTGCGACAGCATGGACTTCTTGGTGAAGTGAACTAG
Protein Length	32
Start Codon	ATT
Location	chr12:110649409-110650200:-
Blocks	110649409-110649475,110650167-110650200
Mean PhyloCSF	-3.64591919292
Data Source	Ribosome profiling;
Related Genes	ENSG00000204852; TCTN1; ENSG00000122986; HVCN1;
Mass (Da)	mono. 3789; avg. 3791.3

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE81802_alt	ENSG00000122986.13	ENST00000356742.9	HVCN1	Protein_coding	Truncated	0.028578	0.008342	1477	1576	NA	NA
GSE81802_alt	ENSG00000122986.13	ENST00000620084.4	HVCN1	Protein_coding	Truncated	0.028578	0.014209	745	844	NA	NA
GSE81802_alt	ENSG00000122986.13	ENST00000439744.6	HVCN1	Protein_coding	Truncated	0.028578	0.014209	839	938	NA	NA
GSE81802_alt	ENSG00000122986.13	ENST00000242607.12	HVCN1	Protein_coding	Truncated	0.028578	0.014209	904	1003	NA	NA

Min Ribo P value	0.028578
Min TIS P value	0.008342

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE81802_alt	CD19+ B cells	WT	GSM2175737	29529302;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA316611	85	CTG	-	110649409-110649475, 110650167-110650280, 110651216-110651295