Specific Information of Small Protein : SPROHSA154397
General Information
| Small Protein ID | SPROHSA154397 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MRHLKCRISP* |
| RNA Sequence | ATGAGGCATTTAAAGTGTAGAATCTCACCCTGA |
| Protein Length | 10 |
| Start Codon | ATG |
| Location | chr22:50085153-50085186:- |
| Blocks | 50085153-50085186 |
| Mean PhyloCSF | -6.57242426728 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000100427; MLC1; |
| Mass (Da) | mono. 1239.7; avg. 1240.5 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR3208885 | ENSG00000100427.15 | ENST00000395876.6 | MLC1 | Protein_coding | 5'UTR | 0.041033 | None | 168 | 201 | 10 | 54.4427689 |
| SRR3208885_alt | ENSG00000100427.15 | ENST00000395876.6 | MLC1 | Protein_coding | 5'UTR | 0.041033 | None | 168 | 201 | 10 | 54.4427689 |
| SRR3208921 | ENSG00000100427.15 | ENST00000395876.6 | MLC1 | Protein_coding | 5'UTR | 0.008065 | None | 168 | 201 | 18 | 121.245962 |
| SRR3208921_alt | ENSG00000100427.15 | ENST00000395876.6 | MLC1 | Protein_coding | 5'UTR | 0.008065 | None | 168 | 201 | 18 | 121.245962 |
| GSE94613_2 | ENSG00000100427.15 | ENST00000395876.6 | MLC1 | Protein_coding | 5'UTR | 0.002117 | None | 168 | 201 | 12 | 75.6669015 |
| Min Ribo P value | 0.002117 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| SRR3208885 | ES cell-derived neurons TSC2+/+ | WT | GSM2082537 | 27655340; |
| SRR3208885_alt | ES cell-derived neurons TSC2+/+ | WT | GSM2082537 | 27655340; |
| SRR3208921 | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
| SRR3208921_alt | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA76182 | 9 | AGG | - | 50085153-50085183 |
SmProt