Specific Information of Small Protein : SPROHSA154397
General Information
Small Protein IDSPROHSA154397
Organismhuman (Homo sapiens)
Small Protein SequenceMRHLKCRISP*
RNA SequenceATGAGGCATTTAAAGTGTAGAATCTCACCCTGA
Protein Length10
Start CodonATG
Locationchr22:50085153-50085186:-
Blocks50085153-50085186
Mean PhyloCSF-6.57242426728
Data SourceRibosome profiling;
Related GenesENSG00000100427; MLC1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR3208885ENSG00000100427.15ENST00000395876.6MLC1protein_coding5'UTR0.041033None168201
SRR3208885_altENSG00000100427.15ENST00000395876.6MLC1protein_coding5'UTR0.041033None168201
SRR3208921ENSG00000100427.15ENST00000395876.6MLC1protein_coding5'UTR0.008065None168201
SRR3208921_altENSG00000100427.15ENST00000395876.6MLC1protein_coding5'UTR0.008065None168201
GSE94613_2ENSG00000100427.15ENST00000395876.6MLC1protein_coding5'UTR0.002117None168201
Min Ribo Pvalue0.002117
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
SRR3208885ES cell-derived neurons TSC2+/+WTGSM208253727655340;
SRR3208885_altES cell-derived neurons TSC2+/+WTGSM208253727655340;
SRR3208921ES cell-derived neurons TSC2-/-Tuberous sclerosis complexGSM208257327655340;
SRR3208921_altES cell-derived neurons TSC2-/-Tuberous sclerosis complexGSM208257327655340;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA761829AGG-50085153-50085183
References
PMID27655340
TitleGenomic analysis of the molecular neuropathology of tuberous sclerosis using a human stem cell model
JournalGenome Med.2016 Sep 21;8(1):94.doi: 10.1186/s13073-016-0347-3.
AuthorsNils Grabole,Jitao David Zhang,Stefan Aigner,Nadine Ruderisch,Veronica Costa,Felix C Weber,Michel Theron,Nikolaos Berntenis,Olivia Spleiss,Martin Ebeling,Gene W Yeo,Ravi Jagasia,Anna Kiialainen
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides