Specific Information of Small Protein : SPROHSA142715
General Information
Small Protein IDSPROHSA142715
Organismhuman (Homo sapiens)
Small Protein SequenceMKGGNFGGRSSGPHGGGGQYFAKPRNQGGYGGSSSSSSYGSGRRF*
RNA SequenceATGAAGGGAGGAAATTTTGGAGGCAGAAGCTCTGGCCCCCATGGTGGTGGAGGCCAGTACTTTGCAAAACCACGAAACCAAGGTGGCTATGGCGGTTCCAGCAGCAGCAGTAGCTATGGCAGTGGCAGAAGATTTTAA
Protein Length45
Start CodonATG
Locationchr8:82291623-82291761:-
Blocks82291623-82291761
Mean PhyloCSF0
Data SourceRibosome profiling;
Related GenesENSG00000254394; AC060765.2; ENSG00000206228; HNRNPA1P4; NONHSAG099581;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR3317843ENSG00000206228.4ENST00000509706.1HNRNPA1P4processed_pseudogeneNovel0.017328None618756
SRR5047770ENSG00000206228.4ENST00000509706.1HNRNPA1P4processed_pseudogeneNovel0.031158None618756
GSE94613_2ENSG00000206228.4ENST00000509706.1HNRNPA1P4processed_pseudogeneNovel0.009502None618756
GSE104033ENSG00000206228.4ENST00000509706.1HNRNPA1P4processed_pseudogeneNovel0.045204None618756
SRR4045277ENSG00000206228.4ENST00000509706.1HNRNPA1P4processed_pseudogeneNovel0.019029None618756
Min Ribo Pvalue0.009502
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE104033HAP-1 cellschronic myeloid leukemiaGSM2788007;GSM278800830143613;
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
SRR3317843U2OS cellsWTGSM210308027406171;
SRR4045277platelet-like particlesWTGSM228591027681415;
SRR5047770iPSC-differentiated dopamine neuronsParkinson DiseaseGSM2402496;GSM2402497;GSM2402498NA;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
MobiDBLitemobidb-liteconsensus disorder prediction145-T
MobiDBLitemobidb-liteconsensus disorder prediction2845-T
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA3458044AAG-82291623-82291758
References
PMID27406171
TitleA conserved abundant cytoplasmic long noncoding RNA modulates repression by Pumilio proteins in human cells
JournalNat Commun.2016 Jul 13;7:12209.doi: 10.1038/ncomms12209.
AuthorsAilone Tichon,Noa Gil,Yoav Lubelsky,Tal Havkin Solomon,Doron Lemze,Shalev Itzkovitz,Noam Stern-Ginossar,Igor Ulitsky
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides
PMID30143613
TitleThe dual methyltransferase METTL13 targets N terminus and Lys55 of eEF1A and modulates codon-specific translation rates
JournalNat Commun.2018 Aug 24;9(1):3411.doi: 10.1038/s41467-018-05646-y.
AuthorsMagnus E Jakobsson,Jędrzej M Małecki,Levon Halabelian,Benedikt S Nilges,Rita Pinto,Srikanth Kudithipudi,Stephanie Munk,Erna Davydova,Fawzi R Zuhairi,Cheryl H Arrowsmith,Albert Jeltsch,Sebastian A Leidel,Jesper V Olsen,Pål Ø Falnes