SmProt

Specific Information of Small Protein : SPROHSA137850

General Information

Small Protein ID	SPROHSA137850
Organism	Human (Homo sapiens)
Small Protein Sequence	MKVSAALLCLLLIAATFIPQGLAQPDAINAPVTCCYNFTNRKISVQRLASYRRITSSKCPKEAVIFKTIVAKEICADPKQKWVQDSMDHLDKQTQTPKT*
RNA Sequence	ATGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGCAGCCACCTTCATTCCCCAAGGGCTCGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGA
Protein Length	99
Start Codon	ATG
Location	chr17:34255349-34256827:+
Blocks	34255349-34255425,34256221-34256339,34256721-34256827
Mean PhyloCSF	-0.503300013294
Data Source	Ribosome profiling; Database;
Related Genes	ENSG00000108691; CCL2;
Mass (Da)	mono. 11017.8; avg. 11024.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE114636_2_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.016877	0.003709	65	365	6	142.005112
SRR3208885	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	6.359E-07	None	65	365	49	29.3446524
GSE45785_3	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.000964	None	65	365	413	580.602043
GSE45785_1	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.001843	None	65	365	95	207.606709
GSE45785_5	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.002054	None	65	365	37	127.767504
GSE45833_3	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.036295	None	65	365	15	17.7748705
GSE45833_2	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.058E-10	None	65	365	134	61.3365649
GSE45833_2_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.058E-10	None	65	365	134	61.3365649
GSE45833_6	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.183E-08	None	65	365	114	64.9317029
GSE45833_6_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.183E-08	None	65	365	114	64.9317029
GSE45785_2	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.828E-05	None	65	365	169	333.478564
GSE45785_2_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.828E-05	None	65	365	169	333.478564
SRR4045276	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.904E-30	None	65	365	580	457.892700
SRR4045276_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.904E-30	None	65	365	580	457.892700
GSE45833_5_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	3.427E-07	None	65	365	186	238.967321
GSE45833_5	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	3.427E-07	None	65	365	186	238.967321
GSE45833_4_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.317E-10	None	65	365	77	55.4553398
GSE45833_4	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.317E-10	None	65	365	77	55.4553398
GSE45833_1	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.551E-05	None	65	365	231	120.335100
SRR3317843_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	8.674E-13	None	65	365	403	1130.49027
SRR3317843	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	8.674E-13	None	65	365	403	1130.49027
GSE129869	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	9.477E-07	None	65	365	77	465.902586
GSE103308	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.942E-06	None	65	365	36	10.6741575
GSE103308_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.942E-06	None	65	365	36	10.6741575
GSE105082	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	7.045E-16	None	65	365	694	157.202167
GSE105082_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	7.045E-16	None	65	365	694	157.202167
GSE89183	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.027873	None	65	365	7	17.0201012
GSE89183_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.027873	None	65	365	7	17.0201012
SRR5047770	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.037E-11	None	65	365	699	184.862652
SRR5047771	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.721E-14	None	65	365	302	46.0370857
SRR5047772	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	6.107E-08	None	65	365	185	109.040751
SRR7207252	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.027873	None	65	365	6	5.28907296
SRR4045277	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.919E-14	None	65	365	74	747.894021
SRR4045277_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	5.919E-14	None	65	365	74	747.894021
GSE83493	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.035883	None	65	365	5	1.99734608
SRR2991181	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	1.333E-07	None	65	365	211	114.958272
SRR618770,618771,618772,618773_alt	ENSG00000108691.9	ENST00000225831.4	CCL2	Protein_coding	Annotated	0.000126	1.033E-05	65	365	8	4.50179734

Min Ribo P value	1.904E-30
Min TIS P value	1.033E-05

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE103308_alt	RD-muscle	WT	GSM2760247	29696588;
GSE103308	RD-muscle	WT	GSM2760247	29696588;
GSE105082_alt	HELA	Cervical cancer	GSM2817679; GSM2817680	30591072;
GSE105082	HELA	Cervical cancer	GSM2817679; GSM2817680	30591072;
GSE114636_2_alt	A549	Lung adenocarcinoma and infected with influenza virus	GSM3146277; GSM3146281	30673779;
GSE129869	Foreskin Fibroblasts	WT	GSM3723750; GSM3723751; GSM3723752	31167946;
GSE45785_1	BJ cells	WT	GSM1115204	23594524;
GSE45785_2_alt	BJ cells	Immortalized	GSM1115207	23594524;
GSE45785_2	BJ cells	Immortalized	GSM1115207	23594524;
GSE45785_3	BJ cells	Immortalized	GSM1115210	23594524;
GSE45785_5	BJ cells	Immortalized	GSM1115216	23594524;
GSE45833_1	BJ cells	Proliferation	GSM1047584; GSM1047585	23594524;
GSE45833_2_alt	BJ cells	Quiescence	GSM1047586; GSM1047587	23594524;
GSE45833_2	BJ cells	Quiescence	GSM1047586; GSM1047587	23594524;
GSE45833_3	BJ cells	Pre-senescence	GSM1047588	23594524;
GSE45833_4_alt	BJ cells	Proliferation	GSM1047589	23594524;
GSE45833_4	BJ cells	Proliferation	GSM1047589	23594524;
GSE45833_5_alt	BJ cells	Senescence	GSM1047590	23594524;
GSE45833_5	BJ cells	Senescence	GSM1047590	23594524;
GSE45833_6_alt	BJ cells	Transformed	GSM1047591	23594524;
GSE45833_6	BJ cells	Transformed	GSM1047591	23594524;
GSE83493	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;
GSE89183_alt	CD34+ hematopoietic cells-Erythroid	WT	GSM2360179; GSM2360180	29551269;
GSE89183	CD34+ hematopoietic cells-Erythroid	WT	GSM2360179; GSM2360180	29551269;
SRR2991181	SH-SY5Y	Neuroblastoma	GSM1970518	31109297;
SRR3208885	ES cell-derived neurons TSC2+/+	WT	GSM2082537	27655340;
SRR3317843_alt	U2OS cells	WT	GSM2103080	27406171;
SRR3317843	U2OS cells	WT	GSM2103080	27406171;
SRR4045276_alt	Meg01 cells	WT	GSM2285909	27681415;
SRR4045276	Meg01 cells	WT	GSM2285909	27681415;
SRR4045277_alt	platelet-like particles	WT	GSM2285910	27681415;
SRR4045277	platelet-like particles	WT	GSM2285910	27681415;
SRR5047770	iPSC-differentiated dopamine neurons	Parkinson Disease	GSM2402496; GSM2402497; GSM2402498	NA;
SRR5047771	iPSC-differentiated dopamine neurons	Parkinson Disease	NA	NA;
SRR5047772	iPSC-differentiated dopamine neurons	Parkinson Disease	NA	NA;
SRR618770,618771,618772,618773_alt	HEK293	WT	SRR618770; SRR618771; SRR618772; SRR618773	NA;
SRR7207252	MCF10A-ER-Src	Breast adenocarcinoma	GSM3150265	30089253;

Database information

Database Name	CCDS_project
Original ID	CCDS11277.1
Cell lines Or Tissues	NA
Phenotype	NULL
Gene ID	ENSG00000108691
Transcript ID	ENST00000225831
Symbol	CCL2
ORF Type	sORF
Gene Type	protein_coding
Interaction	NA
Function Description	NA
PMID	19498102; 22434842; 24217909;
Database Name	UniProt
Original ID	P13500
Cell lines Or Tissues	NA
Phenotype	NULL
Gene ID	ENSG00000108691
Transcript ID	ENST00000225831;
Symbol	CCL2
ORF Type	sORF
Gene Type	protein_coding
Interaction	NULL
Function Description	"FUNCTION: Chemotactic factor that attracts monocytes and basophils but not neutrophils or eosinophils. Augments monocyte anti-tumor activity. Has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis or atherosclerosis. May be involved in the recruitment of monocytes into the arterial wall during the disease process of atherosclerosis."
PMID	2923622; 2513477; 2465924; 2518726; 2357211; 1661560; 8107690; 10918580; 14702039; 15489334; 2648385; 2322286; 2071154; 8195247; 8627182; 8898111; 9792674; 9837883; 10587439; 10529171; 15033992; 23233732; 23765988; 1857712; 8639605; 8989326; 16352737;

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO
ProSitePatterns	PS00472	Small cytokines (intercrine/chemokine) C-C subfamily signature.	34	76	-	T	IPR000827	CC chemokine, conserved site	GO:0005576\|GO:0006955\|GO:0008009
SMART	SM00199		31	90	3.5E-28	T	IPR001811	Chemokine interleukin-8-like domain	GO:0005576\|GO:0006955\|GO:0008009
Gene3D	G3DSA:2.40.50.40		24	99	7.4E-28	T
SUPERFAMILY	SSF54117		27	98	4.85E-25	T	IPR036048	Chemokine interleukin-8-like superfamily	GO:0005576\|GO:0006955\|GO:0008009
CDD	cd00272	Chemokine_CC	34	91	4.64456E-23	T
Pfam	PF00048	Small cytokines (intecrine/chemokine), interleukin-8 like	33	90	7.6E-23	T	IPR001811	Chemokine interleukin-8-like domain	GO:0005576\|GO:0006955\|GO:0008009
PANTHER	PTHR12015		1	98	3.1E-59	T	IPR039809	Chemokine beta/gamma/delta	GO:0008009
PANTHER	PTHR12015:SF98		1	98	3.1E-59	T

Disease	Detected
Chronic inflammatory disease	Reported
Allergy	Reported
Atherosclerosis	Reported
Autoimmunity	Reported

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
17-34255390-C-A	Non-Synonymous p.A14E	.	SRR6181538; SRR6181540
17-34256250-T-C	Synonymous p.C35C	rs4586	SRR3317843; SRR4045276; SRR4045277; SRR5047771; SRR5047772; SRR8310199; SRR6181538; SRR6181539; SRR6181540; SRR6181541

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results

a reliable repository with comprehensive annotation of small proteins derived from ribosome profiling