Specific Information of Small Protein : SPROHSA136706
General Information
Small Protein IDSPROHSA136706
Organismhuman (Homo sapiens)
Small Protein SequenceMKIEDKLENLEKPKQISHIEGKKKNKTKWEGRNVERYTLF*
RNA Sequenceatgaaaatagaagataaattagaaaatttggaaaaacccaaacagatcagccatattgaagggaaaaagaaaaacaaaacaaagtgggagggcagaaatgtagaacggtatacactcttttaa
Protein Length40
Start Codonatg
Locationchr7:102988450-102988573:+
Blocks102988450-102988573
Mean PhyloCSF-8.17312196406
Data SourceRibosome profiling;
Related GenesENSG00000161040; FBXL13; ENSG00000230257; NFE4; NONHSAG048439;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000230257.4ENST00000420058.1NFE4protein_codingNovel0.003468None666789
Min Ribo Pvalue0.003468
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA10405138ata+102988456-102988573
References
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides