SmProt

Specific Information of Small Protein : SPROHSA136192

General Information

Small Protein ID	SPROHSA136192
Organism	Human (Homo sapiens)
Small Protein Sequence	MKKRPTEEKKAGRSKGKKKKRKKR*
RNA Sequence	atgaaaaaaagaccaacggaagaaaagaaagcaggaaggagcaaaggaaagaagaaaaaaagaaagaagagataa
Protein Length	24
Start Codon	atg
Location	chr7:27168840-27168915:+
Blocks	27168840-27168915
Mean PhyloCSF	-8.49664001465
Data Source	Ribosome profiling;
Related Genes	ENSG00000078399; HOXA9; ENSG00000257184; AC004080.3; ENSG00000253187; HOXA10-AS; NONHSAG047189;
Mass (Da)	mono. 2910.8; avg. 2912.6

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR4045276	ENSG00000253187.2	ENST00000519694.1	HOXA10-AS	LncRNA	Novel	0.039725	None	222	297	4	12.6315227

Min Ribo P value	0.039725
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
SRR4045276	Meg01 cells	WT	GSM2285909	27681415;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA1344	16	aag	+	27168864-27168915