Specific Information of Small Protein : SPROHSA136192
General Information
| Small Protein ID | SPROHSA136192 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MKKRPTEEKKAGRSKGKKKKRKKR* |
| RNA Sequence | atgaaaaaaagaccaacggaagaaaagaaagcaggaaggagcaaaggaaagaagaaaaaaagaaagaagagataa |
| Protein Length | 24 |
| Start Codon | atg |
| Location | chr7:27168840-27168915:+ |
| Blocks | 27168840-27168915 |
| Mean PhyloCSF | -8.49664001465 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000078399; HOXA9; ENSG00000257184; AC004080.3; ENSG00000253187; HOXA10-AS; NONHSAG047189; |
| Mass (Da) | mono. 2910.8; avg. 2912.6 |
Ribosome profiling
| Min Ribo P value | 0.039725 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |       |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA1344 | 16 | aag | + | 27168864-27168915 |