Specific Information of Small Protein : SPROHSA136192
General Information
Small Protein IDSPROHSA136192
Organismhuman (Homo sapiens)
Small Protein SequenceMKKRPTEEKKAGRSKGKKKKRKKR*
RNA Sequenceatgaaaaaaagaccaacggaagaaaagaaagcaggaaggagcaaaggaaagaagaaaaaaagaaagaagagataa
Protein Length24
Start Codonatg
Locationchr7:27168840-27168915:+
Blocks27168840-27168915
Mean PhyloCSF-8.49664001465
Data SourceRibosome profiling;
Related GenesENSG00000078399; HOXA9; ENSG00000257184; AC004080.3; ENSG00000253187; HOXA10-AS; NONHSAG047189;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR4045276ENSG00000253187.2ENST00000519694.1HOXA10-ASlncRNANovel0.039725None222297
Min Ribo Pvalue0.039725
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR4045276Meg01 cellsWTGSM228590927681415;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA134416aag+27168864-27168915
References
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia