Specific Information of Small Protein : SPROHSA1344
General Information
Small Protein IDSPROHSA1344
OrganismHuman (Homo sapiens)
Small Protein SequenceKKAGRSKGKKKKRKKR*
RNA Sequenceaagaaagcaggaaggagcaaaggaaagaagaaaaaaagaaagaagagataa
Protein Length16
Start Codonaag
Locationchr7:27168864-27168915:+
Blocks27168864-27168915
Mean PhyloCSF-8.01682354422
Data SourceRibosome profiling;
Related GenesENSG00000078399; HOXA9; ENSG00000257184; AC004080.3; ENSG00000253187; HOXA10-AS; NONHSAG047189;
Mass (Da)mono. 1911.3; avg. 1912.4
Ribosome profiling
Ribo-seq IDEnsembl Gene IDEnsembl Transcript IDSymbolGene TypeTIS TypeRibo P valueTIS P valueStart On TransStop On TransIn-frame CountRibo-seq RPKM
SRR4045276_altENSG00000253187.2ENST00000519694.1HOXA10-ASLncRNANovel0.032653None246297313.9318265
Min Ribo P value0.032653
Min TIS P valueNone
Ribo-seq IDCell or TissuePhenotypeRibo-seq Source DetailsPMID
SRR4045276_altMeg01 cellsWTGSM228590927681415;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
Variant IDConsequence to sORFrsIDRibo-seq ID
No results
Related Small Proteins with Different TISs
SmProt IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA13619224atg+27168840-27168915