Specific Information of Small Protein : SPROHSA136183
General Information
Small Protein IDSPROHSA136183
Organismhuman (Homo sapiens)
Small Protein SequenceMKKNNIPEPVVIEIVWSNVMSAVEWNKREEIVAEQAIKHLKQHSPLLAAFTTQSQSELTLLLKIQEYCYDNIHFMKAFRKIVVLFIKL*
RNA SequenceATGAAAAAAAACAACATCCCAGAACCAGTTGTCATCGAAATAGTCTGGTCAAATGTAATGAGCGCTGTGGAATGGAACAAAAGAGAGGAGATTGTAGCAGAGCAAGCCATCAAACACTTGAAGCAACACAGCCCTCTACTTGCTGCCTTTACTACTCAAAGTCAGTCTGAGCTGACCCTGTTACTGAAGATTCAGGAGTATTGCTATGACAACATTCATTTCATGAAAGCCTTCCGGAAAATAGTGGTGCTTTTTATAAAGCTGTAG
Protein Length88
Start CodonATG
Locationchr3:172425991-172426258:-
Blocks172425991-172426258
Mean PhyloCSF-3.12735438846
Data SourceRibosome profiling;
Related GenesENSG00000236686; BZW1P1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE104033ENSG00000236686.1ENST00000454901.1BZW1P1processed_pseudogeneNovel0.030025None8311098
GSE104033_altENSG00000236686.1ENST00000454901.1BZW1P1processed_pseudogeneNovel0.030025None8311098
GSE83493ENSG00000236686.1ENST00000454901.1BZW1P1processed_pseudogeneNovel0.039241None8311098
GSE83493_altENSG00000236686.1ENST00000454901.1BZW1P1processed_pseudogeneNovel0.039241None8311098
Min Ribo Pvalue0.030025
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE104033HAP-1 cellschronic myeloid leukemiaGSM2788007;GSM278800830143613;
GSE104033_altHAP-1 cellschronic myeloid leukemiaGSM2788007;GSM278800830143613;
GSE83493HeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;
GSE83493_altHeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA23130125ATT-172425991-172426069
SPROHSA1376026AAG-172425991-172426072
SPROHSA15296869ATG-172425991-172426201
SPROHSA2876591AAG-172425991-172426267
References
PMID28460002
TitleProteomic analysis of polyribosomes identifies splicing factors as potential regulators of translation during mitosis
JournalNucleic Acids Res.2017 Jun 2;45(10):5945-5957.doi: 10.1093/nar/gkx326.
AuthorsRanen Aviner,Sarah Hofmann,Tamar Elman,Anjana Shenoy,Tamar Geiger,Ran Elkon,Marcelo Ehrlich,Orna Elroy-Stein
PMID30143613
TitleThe dual methyltransferase METTL13 targets N terminus and Lys55 of eEF1A and modulates codon-specific translation rates
JournalNat Commun.2018 Aug 24;9(1):3411.doi: 10.1038/s41467-018-05646-y.
AuthorsMagnus E Jakobsson,Jędrzej M Małecki,Levon Halabelian,Benedikt S Nilges,Rita Pinto,Srikanth Kudithipudi,Stephanie Munk,Erna Davydova,Fawzi R Zuhairi,Cheryl H Arrowsmith,Albert Jeltsch,Sebastian A Leidel,Jesper V Olsen,Pål Ø Falnes