Specific Information of Small Protein : SPROHSA136001
General Information
Small Protein ID | SPROHSA136001 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | IFARKREIQLSSVSRKLSSSSS* |
RNA Sequence | ATCTTTGCTAGAAAGAGAGAGATCCAGTTGTCATCGGTATCCAGGAAGCTCTCCTCTTCCTCCTCCTGA |
Protein Length | 22 |
Start Codon | ATC |
Location | chr1:203627200-203682791:+ |
Blocks | 203627200-203627219,203682741-203682791 |
Mean PhyloCSF | -5.74279707066 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000058668; ATP2B4; ENSG00000236035; AL513343.1; NONHSAG003999;NONHSAG057114;NONHSAG105657; |
Mass (Da) | mono. 2465.4; avg. 2466.8 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45833_5_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.001344 | None | 414 | 483 | 31 | 173.164726 |
GSE45833_6_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.006384 | None | 414 | 483 | 22 | 54.4812152 |
GSE45785_1_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.035274 | None | 414 | 483 | 6 | 57.0087075 |
GSE45833_5_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.001344 | None | 640 | 709 | 31 | 173.164726 |
GSE45833_6_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.006384 | None | 640 | 709 | 22 | 54.4812152 |
GSE45785_1_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.035274 | None | 640 | 709 | 6 | 57.0087075 |
Min Ribo P value | 0.001344 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45785_1_alt | BJ cells | WT | GSM1115204 | 23594524; |
GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
GSE45833_6_alt | BJ cells | Transformed | GSM1047591 | 23594524; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA257642 | 86 | CTG | + | 203627008-203627219, 203682741-203682791 |