Specific Information of Small Protein : SPROHSA136001
General Information
| Small Protein ID | SPROHSA136001 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | IFARKREIQLSSVSRKLSSSSS* |
| RNA Sequence | ATCTTTGCTAGAAAGAGAGAGATCCAGTTGTCATCGGTATCCAGGAAGCTCTCCTCTTCCTCCTCCTGA |
| Protein Length | 22 |
| Start Codon | ATC |
| Location | chr1:203627200-203682791:+ |
| Blocks | 203627200-203627219,203682741-203682791 |
| Mean PhyloCSF | -5.74279707066 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000058668; ATP2B4; ENSG00000236035; AL513343.1; NONHSAG003999;NONHSAG057114;NONHSAG105657; |
| Mass (Da) | mono. 2465.4; avg. 2466.8 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45833_5_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.001344 | None | 414 | 483 | 31 | 173.164726 |
| GSE45833_6_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.006384 | None | 414 | 483 | 22 | 54.4812152 |
| GSE45785_1_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.035274 | None | 414 | 483 | 6 | 57.0087075 |
| GSE45833_5_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.001344 | None | 640 | 709 | 31 | 173.164726 |
| GSE45833_6_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.006384 | None | 640 | 709 | 22 | 54.4812152 |
| GSE45785_1_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.035274 | None | 640 | 709 | 6 | 57.0087075 |
| Min Ribo P value | 0.001344 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45785_1_alt | BJ cells | WT | GSM1115204 | 23594524; |
| GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
| GSE45833_6_alt | BJ cells | Transformed | GSM1047591 | 23594524; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA257642 | 86 | CTG | + | 203627008-203627219, 203682741-203682791 |
SmProt