Specific Information of Small Protein : SPROHSA12366
General Information
Small Protein ID | SPROHSA12366 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | KIQKLMDVGLIAIR* |
RNA Sequence | AAGATCCAGAAGCTGATGGATGTGGGTCTGATTGCAATTCGGTGA |
Protein Length | 14 |
Start Codon | AAG |
Location | chr11:64204081-64204126:+ |
Blocks | 64204081-64204126 |
Mean PhyloCSF | 6.2559999903 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000168439; STIP1; |
Mass (Da) | mono. 1597; avg. 1598 |
Ribosome profiling
Min Ribo P value | 0.035455 |
Min TIS P value | 0.025433 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE81802_alt | CD19+ B cells | WT | GSM2175737 | 29529302; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA190162 | 96 | ATG | + | 64203183-64203228, 64203449-64203622, 64204053-64204126 |