Specific Information of Small Protein : SPROHSA12366
General Information
Small Protein IDSPROHSA12366
OrganismHuman (Homo sapiens)
Small Protein SequenceKIQKLMDVGLIAIR*
RNA SequenceAAGATCCAGAAGCTGATGGATGTGGGTCTGATTGCAATTCGGTGA
Protein Length14
Start CodonAAG
Locationchr11:64204081-64204126:+
Blocks64204081-64204126
Mean PhyloCSF6.2559999903
Data SourceRibosome profiling;
Related GenesENSG00000168439; STIP1;
Mass (Da)mono. 1597; avg. 1598
Ribosome profiling
Ribo-seq IDEnsembl Gene IDEnsembl Transcript IDSymbolGene TypeTIS TypeRibo P valueTIS P valueStart On TransStop On TransIn-frame CountRibo-seq RPKM
GSE81802_altENSG00000168439.16ENST00000358794.9STIP1Protein_codingTruncated0.0354550.02543322812326NANA
Min Ribo P value0.035455
Min TIS P value0.025433
Ribo-seq IDCell or TissuePhenotypeRibo-seq Source DetailsPMID
GSE81802_altCD19+ B cellsWTGSM217573729529302;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
Variant IDConsequence to sORFrsIDRibo-seq ID
No results
Related Small Proteins with Different TISs
SmProt IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA19016296ATG+64203183-64203228, 64203449-64203622, 64204053-64204126