Specific Information of Small Protein : SPROMMU37399
General Information
Small Protein ID | SPROMMU37399 |
Organism | Mouse (Mus musculus) |
Small Protein Sequence | RKWRQS* |
RNA Sequence | AGGAAATGGAGGCAAAGCTGA |
Protein Length | 6 |
Start Codon | AGG |
Location | chr1:11186645-11186666:+ |
Blocks | 11186645-11186666 |
Mean PhyloCSF | -5.63814292635 |
Data Source | Ribosome profiling; |
Related Genes | ENSMUSG00000048960; Prex2; NONMMUG000100; |
Mass (Da) | mono. 859.5; avg. 860 |
Ribosome profiling
Min Ribo P value | 0.026316 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE81283_2_alt | C57BL/6JRj-kidney | WT | GSM2149122 | 28622766; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |